Arabidopsis_thaliana Locus Mono:SnoR33
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR33
Arabidopsis_thaliana
Mono:SnoR33
2
SnoR33
1001..1085
2085
TAACTGCATCGACATGTTTGTGTTTTAGAGGAATTGAACTGAAACTCACATGCAGAACT
TCAATGGCCAAGTTCAATGGCACATGCTTCTCAACATCAAACTTCACAGGATGCTGCATC
TGAAAGTTGATACACATGACTCGGAAACCGAATGTAGAACTTTGCCTCAGGTTTCAAAGC
AAGCTGCAGAATATGCTCATACACCATTTGCCAAAGTCAAAAGCCAACTTTTGTGCAATC
TGATACACAAGCAAAGCCGTGTCTATACTTGCATATCCCTCGCTGGTTGTTGGAGACCAA
TTTCTGCACGAAAACTTTAACAGCTTCCTATAGTTTTTCGAGAAGGTGCTCATGGGAGGA
GTCTGAAGAACCTTCACTTGTCCATCAGTAAGATAGTTGGTGACCTCATCATCAATCAAA
CCAATAATTTGCAACTGTTAAGCTCTGGCATCAACTGATTGTAGACCAAACAAAACTTTG
ATCTTGGCAGGAGAGAATTCGTACTCCATGCCTCGCACACATACCTTGACAGAATCGTCT
TCGACCTCTTGTTAGCATCATGAGTGATAAGTCGCAAGCGGTGAAAGCCAACTTCATCAG
CAACACTTGAACCAGCAGCTTCCTTCCCTTTTTTAGTCTTCTGTCTTTTCACCTTCTTCA
CAGCACCAGACTGTTTCCTTTTCAGCAAACGCGAGGACACAGATAGATCCGTCGAGTTAG
CAGCTGGTACGGATTCAAACAGAGATCTGGGACCACTTGAGGATTCTCGTTGTTGAGTGG
TGAAACTTGGTCACACGTCTGGCTTTTGGCTCAGCAGGAATGGGTGTCTCAGATCTATGA
ATAGGAACAACAATAGATTCACACTCGGTGGCTCTGGAGATACGGCTGCCTGTTCATCTT
GTTTCTCCTTGTGTGGAAGGTCAGATCTGAGAGGTGTCAGTTCGGGCTCAGCATACAACA
CCATAGCTTTGTTTAGATTTTCTTCCTCTTCAGCTTTCAGAGACTGTGATGGATCCTCCT
CAGAGGCTGTTTCTGAAAGGTCCGACGACGGTCTCACAGATCTTTTTTGCACGAGCCGTT
GAAGTCCAGAGAATATCGCATTCATCTTCAAGAAAGATTTAAACTTGATTCTCTTTGAGC
ACAAGTCTTCGAGTTAACGACTCCCTAGGCAGGTTTGATTTGACATGAGAAACCCTAACT
CTTTTTCCCTCCAACCTAGACATTAAGTAATGGGCTTAATTTATTCATGGGCCTTCAAAA
CAAATGGGCTTAAACTATACCTAAAATAATTAGAGCCTGAAACACTAAACAAAAACATTA
GTGCACACTTGCAAATAATCCCATTGATTCATATCATCCCATTCATCAACATCACATGTT
AGAATAGTTCTGATTAAAAATCATTTAGCGAACAACCATTCACTCATGAACAGAGTTTAG
TGACCCAGAAAGTTATTGAAACATGTGAGTACACTACGTTGGATTCAAAACATTTTTATA
CCTTTGAGATCTGTTCCGTGTTACGTGCCAACCAGTTGTTCAGAACTCAGCAAGAAGCTA
CCATAACCACTCATATCTTTGATAGATCAACTCTGGGTACAGTGGCTAGTCTTTCACACT
GTCATGCCTTCAATTCAAGTAGATCAGCTCAACGTGTAACAGGCAGCTGGAATTTTCCTT
TGGAGATTGCTCAAAGAATCAGGAGTGTGCTGCTTTTATTTCCACACTTCCTCAGATTTA
GATACAACAGGGTTCTCCTTTTTTTTTAAACTTTGAATCCCTGTTGATCTATCAGTTTCA
TATCAGCAACATCACTTGACTTCTCAACTGCTGATATCAGTGCATGATGGTCACTTGACA
CCAAATTAGGCTTTAGATACCCTTAGTTTGGTTTGCACAATAAGTTGATCTCCTCAGCTC
TTTGACCTCCTGTTAGACGACAACGTTTTACGGCTGACTACAGAATCAGCATGACAGGCA
GCTATTTTCCACACATCTTTATTCACATAGTGTTGATCTTCTATTCATCCTTGGATTTCC
ATGGCCTGTTCTTGCATTTTTTGTTCCTGTCTTAGATCAACACATC
  Untranslated Region
  Coding Sequence
  snoRNA
AT2G10510.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved