Arabidopsis_thaliana Locus Mono:SnoR109-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR109-2
Arabidopsis_thaliana
Mono:SnoR109-2
2
SnoR109-2
1001..1104
2104
AAGATGAATGAAGAAAACAATGATTAGATAGAAGTTCCGGTGATGTTGTAACGCTCAGG
CGTTAAACACAGACTGGGAAGACGAGTTAACGAAGCAAGGGACGTTTCGTATTTCCGTTG
ATGATGCTGACATGGAATGATGACATGGAATATTACAGCCGACGTCGTTTTGAAGTGATG
AGGTGGCAAGTAAGCCACCAAACGAACATTTGATAACTCAGCCATCAAGCAAATCTATAA
GTCAGTCGCAACATGAATACTATTACAGTTATTAAAAAGGAAGAAAACAAAGTTAAGTCA
GCCGTGTAATGTCGTAACTCAACTAACTCAGCCGTATCGTTTAAAATCTCGGCCCTAACT
GCATGCTATTATAGTAATTAATCTTTTGCACATAAGTCAGTCATAACAAGGCCGAGTTAT
TTGGAAATTCAGCTCTTTACGGCTGATTTGTAACACTCGATAATAACTCAGCCGCAACAT
CATCCCATAACTAAGCCGTCCCGAAATATAACTCAGCCGTCACGAGGATATAAGTCAGCC
GTTTTCTCATAAATCAGCCATCACGTTGTCTGGGTTATGCTATAAATACTTATAACTGGG
ACAACATTCCTTAACTCAGCCATATCGTTGTCTGGGTTATTGTATAACTCAGGCAACATT
TTACAAATCAGCAGTAATGTGTGGCTGAGTTATACTCATACTTCGCCGTTTTGTCATGAC
TCATATATTTTGGTTATGACTCATATATTTTTGTCGTATGTCAGCCGCAACATACCGTAA
CTCAGCCGTAACTGCCGCTGTATCGCGTTACGGCTGAGTTCATTTAATCCACGTCAGCAA
TTTCTGACGTGGCAATGACATTCCTTGTAATTACGTTTTTTTCCGGTAATGTTTAGTAGG
AACACGCTGGATATACAAAAAAAGACGACAATATGACAGTAATAAAAAAAGTTCCATCTG
GTTCCGTTAATATATGATTTTTCTTGAATTTGTCAAAAAAACTGTTGTACCTAGCTTAAA
TAAGAAGTTAATTGGCCGGTGGTCGTGAGAGAGATTTAGATCTCTCCGGTTGATTGTTTA
TTACATTTTCTGTTTTCTCACCAGTCCTTTGATTCGTAAATATTAGATTTTTGATGAAGT
GATTTATGAGAGAGATTGTTAAAGTATAGAGAATATCAGTTTTTAAAAAAACCTTTTTCG
AAAGTTCTTTCTGGTTAATTAAAATGAGGTCTCCTTTCCTGGCGATATGTTCTTACATCA
TGAGCAAGTATGTGTCTTATTGTTGCACACATATATTCATATCGCAAATTTAATCAAGAT
CTGATTTTTAAAACTATATTTATTTGTTATAGACTGATCACATTTAACCATAAAGAAAAA
GTTGACAAAGATTAAAGTGAATTCAAAGTGCCCTGAATAACTGATATGACTGTCATTAAC
TAAATTGTTTTATGAGAATTGTGATAATTTATTGGGACGTTATCAAAGAAAAAATAGTGG
TGGTATTCACTGTTCGGTTTGTTTTAGCCAAATTACAACGATTCTAAAACTGTAGGTTCT
ATTTAATTCTTCACAATTGTTGTCGCCTATGTGATGAGGGACGGAAGCTATGTAGAGAAG
GAGGCTCTGTTTTGGTTTAGCAAAACAGAGTACTTAAAAGATGAAGATGGGAGTGAATGA
ACGAATGAATATGAAAGGGGATAGGGTTGAATTCGGTTCTAGGAATCACATATCATCTCA
GGATGAAAAGAGAATTTGCTCCATACCATCTTAGGAATCCGTCTGAAACTACCCCATATT
CGTGCTACATTTGCTTGTGTTTTTATCTTCGTGCTACATTTTATTAGATTTTCATTTCTG
GATCAAAAAGTTTCGTAATATTCTAATGACATGGATTATATTTTCTGGGTTAAATCATAC
TTTAAGTCTTGAAATTAGAAACTAAATAAATTAATAGTTTATTCGCTTATAATAAATACG
TTAATTACATTGGTAATTCATACCTACATATTGGACATATATGACTAGTCTGTAGCCATT
TTACAATACATGTGTAATCAAACCTATGACCACAACTTAATTTGACTACTTTTGTTCCGA
AATAA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003071.7
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved