Arabidopsis_thaliana Locus RPL34
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana RPL34
Arabidopsis_thaliana
RPL34
1
AT1G09083, SnoR110
1523..1660, 1829..1911
3630
cgttcttcgaagaagaaatgtagatatgaaggagaattcgcggtaaagactgaaatgtt
gagagagattatccgagagtcgatgagtgttttctgggagtttctttgtgcagacaaaga
cgagtttacttcaatgatgaaagtttctcaccaaactcaagtctctccacaggattcttt
agaccttgagctcttgacagatatcagaactcatctccaaaaggtatttaaaaacttcaa
attcttgctctcattttgtcagattacatcaatgtttaacaattcactcaagaacctgtt
cttggcctaatgtagaaagagaagaagctaaaggaaatacaaagaagccaaagctgtata
gtgaagaagttaaagaagaatgaatcaaagagtagtattggtgtgaaggatgaattacta
atagctaaaattgaactgagactggtttcaagagtgatgtacatgtcgaaacttactact
gagaagttacattggtgtcaggagaaacttgaaaagatcagcttcaacggtcggaagatt
catatggaaccatatttctcgttgttaccttgttgagccatctctgcgtatagattagat
catagatgttggaacaatatggcttcatcagatccaggaagatgtctttttgttgttgtt
catatcttcctgagaacaatagtatatctaatgaatgatatgtggtagcttagcgttttt
ctttctcctctaatcaccacaacatctggaatcacctcgaagaacattttgagaactaga
agtaaagttgattaacatttggtacatgaacacaaatcttcttgaacgttgttgaactag
tgattactgattaatgaataattaaagaaaagacaaacgttcgaaagatgggcctttggg
ccaagtcatatttggattattatgtaagcattaacaagcccataaaatgtcgtccattga
tgatcataagtcaatatgtaatctgaaccgtccgatctagggctttaggtgttgaagtga
aaaaagaccctatataaagataatatagcttataaagtctcttctctgctccgtcaagct
gaggaggataaaaaccctagggtgagtgagacagagagaagcgaaaatggtgcagcgcct
tgtttaccgatcacgacacagttacgccaccaaatccaaccagcacaggatcgtcaaaac
tccaggtctgttctgtttcttcaatcgcatatgctgaaattcacaaatctgtatccatgg
atctataagatttgaaatgtattgacgtattgatgatttgcaggaggtaaattgacgtac
cagaccactaagaagagagctagtggacctaaatgtcccgttaccggcaagcgtattcag
ggtgttagtattcttcagattcatattctctccgatttgagtctaaagttacatactttg
tttgattttggattgacccatttgattgttttgaggttattctattgattgatgcaaatg
tagtagtttaggtttggtttgtttgtgcttattgacggtcttgtgctggttagatgaatt
caacatcagtagataactttatcataagctaaatgtagtgccgctttgtctttttcaagt
tttctctgtggagtaagctttaatcttggtggcagaaataggtaaatcatcttggaaact
tttcactaggtttagatttgtttgttttgccatcttgatggtaaattgtattagttttag
attctgtattgtattgatttcttcttgtgcttattgacggtcttgtgctggttaagatta
atccacaccagtacataactttatcataagctaaatttagtgccgccttgtcttttcaag
ttttctccttttgtatgtaaggaatcacttttatacttggtggcataaatcttcaaacat
cttgtaaattgttcatagtttggtttacagtaatcttaaagttgatggagttgtttcagc
cattttccttcagcatctaatttatatctctttggttgtttagattcctcacttgaggcc
aactgagtacaagaggtcacgtttatcaagaaacaggaggaccgtgaaccgtgcttatgg
tggggttttgtctggttctgctgttagggaaaggttcgttcttgagttcaattttgtatt
tgctttgtgcctttgtaaccaaagacaaatcttaatggttgttcttgtgtgttacagaat
cattcgtgccttccttgtggaggagcaaaagattgtgaagaaggttttgaagcttcagaa
ggcaaaggaaaaggttgctcccaagtgatctagaccctattagtttttatgttttatggc
tctgttctagcgatagtactggttgcagagaaaaacattgtgtactcatcaaaaaattta
agcttttttgtattggttttggatctttggctctgtctacaattcgtttcggttttcgtt
tcttgttcatgttgagttcacatttcacgttttcaattcttacccccgaaacttcctatt
ggttacaaatgatttatactctttttttctcttttgagcctaaaactttaacttctgcaa
tatttgttacatgagtgattatctataatagatggttgtgcaaatttctttggcctcgtt
tattttaacccccaccaaatttagtagcgttctttcttaacatctcccaaagcatatctt
tgccacgatggagtgatactgattgatttgtgccaaaaacatgattcgtttacgaactta
agcacttcaatatcatcacaaactaaaagaaaacagagaattcgtattaactaagtactt
agagacaacaaccttgtacgtttattggtgatgactacgaggatcatcagagaacgacaa
ctttggatgatgtagagagtcttggaatggcaaggagttcttttaggatgacagaatctt
ctttcttcacggaatcatccaagcatagggtcagtttcttgaggatggttgaattctcaa
gtaagtaactcactagtttcatctccatcgcctctcctttcaatggcctttctatcttaa
catactcgagagatgataggaaacgcctaggtcccggcaaaataatattttctcccttct
cctgataactagcagatttctgcatataccgagtgaaagaaacacaagttcaagatatga
taaactttcaccattttgcatcttaataagaatttcatggttcaatagacaatactcacc
acgacaagagtttttagattcgggcagctctcaagaaagattggcaacatttcccacatg
tagccgtaaaactcaacacacaagacagataggttacggaataagggtagtcgttcacat
cttgagaaatcatagataacctgtaaggaaaaaaaaaagtatcaggaaagaataaagtta
cacattcaatcaaatagcaaattcaacattgtagtgtacctcaagagtactcgaaaaaat
gatcatatctttaatagtagagatgccgaggagaaaattacgtatcatagttctctttgg
tagatcatctggattaaacttattcacggaactcaagttaaacacaatatcgatatccgc
tttgacaagcttaccgggtttattaagtata
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1204, 1303..1382, 2023..2132, 2217..2630
1126..1204, 1303..1382, 2023..2132, 2217..2307
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved