Arabidopsis_thaliana Locus Mono:SnoR109
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR109
Arabidopsis_thaliana
Mono:SnoR109
4
SnoR109
1001..1101
2101
TAATCAAACTTCTAGCAAAAACCTTATAGCTCAATCCAATGCAACAAGAACATTGAACC
AAAAACCAAAAACTAACCGGAACGTATTTGAATCTCCGCCGTGGAGGATCTTCTGCCACC
GTTGCCACCGTATCCTCGCTCGGAGAATTACTCTCACTTTTACCATCTTCATTGCCGTTA
CCATTCTGAGACAATGGTGCCCACTTATACAGCAACAAATGCGATCCATTACTACCGTCA
GAATTCGAACCACCGTTAACGACGGAAGCTGCAGCAGCGGCGGAACCGGAGGAGCTATTA
TTATTGTCTTTCTTAGAGGAAGGAGAGACGTGTACCCACTTCTTCTTCCACTTCCTCACC
GGTCCGGTGAAAACCGTTGCCGGTCCGTACCGTGTCGAGGACCTACCTAACCGTGCACCA
ACTCCTTCCATAACGACGAATCGTTTATCGTTGATTCACTGATCAAAATTCAAATTTAAA
ATCCCACCAATCTGTTTAATGAAACTTTGTTTTCAAATTTCTTAAAAGTAAAATTTGCTC
TTTCCACCGAAGGAAGAACTCAGATCTCAGTTTTTGCGAAGCGACCAATTTTATTGGTTT
TTGCTTCAAGTAGAAGACTCTTGTTGAGCAAGAAGGTTTGACTATTGACACGTGTGTGAT
AGTTATAGGCTAATCTAATTATACTTAACAATAATTGCTTTTGTTTGAGAAAGAGAAAGA
CTCTGTCTAAACCAGAGGGTCTCGGCTAATCGTTTTGACCTAGTAGCGTCATCATAGAGA
GTTTAGTGGAAAAGACTCTGATACCCCTGAAGTTCTCTCCTATATAAACATCGCTTCAAC
CTTTCAGCTACATCATCTCTTTCATTACGACGCCTAGGTTTAGGGTTTTCAACATCAATT
TTTTTGAATCAGATTAGTTTTTTTTTTTTTAAATTGGGGCTACATTGTACCGAGAGAAGG
GCTCGATTTCGATACCTTTACTCTTGAATTTGCCAAAAAAACGGCTGTAGCTAGATTGAA
TAAGAAGCTATCTGGCCGGTGGTCGCGAGAGGGATTTAGATCTCTCCGGTCGATTCATCT
GCTTACCGAGTTTCTTACATTTTCTTTTTGATTTTCTTAACATCTTTTGATTCGTTTTAT
TGAATGATTGGATATAGTGAATAGGGAATAGCAGATTTTAAAATACCATTTTCGATAGTT
CTTTCTCGTGTATTAAACTTAGGGTTCCTTTCCAGGCGTTCTGTGCTCTCTTCATGAACA
GTTGTGTCTTATTGGTACCTACATATGTATTTTTTTTACATTGATCGCATTTAACCAAAA
GTATAACAGTCGATAAAGATGAAAGTGATTTAGTATGGCCCTGAATAACTTATGTGATTT
AATTCGACCAAAAAATTGTTCCATTGAATTGTCATAATGAAGATTGAATTGTTTTGGACC
TAATCAAAGGAATAAACATTTGTCATTTGGACCTAATCAAAAGAAATATATTTGAATTGA
ACCAACTCAAAGGAAAATGTTAGTTTTGTTTTGACCGAAACTAATCGTTAATTGTCGCTG
TCGCATATGAAACAGAGTACTTGCAAATGAATTAAGAAAACGAGAAGCCTGGGAATGAGT
TTGTGATATTGGTTTGAAATAGTAGATGTGAACAATAACCATTTTCAGCTCCAGAAATTA
GACTGAATGGACCTCTTGTTGTATATTAGAATTCATAAAACAAGATATGTATATTACCCC
CAAAAATTAGAGAAGTGTTTGTTCTCGATGAAACGTTAGATCTTGTAAACCAAACTAAGT
ATTTAGATCTGGTAGAGTAAACCTTCTAATACACTGCAATCAAGTCCCAAGCAAACAAGA
TTTGAATTTGAAAACACAAATTTAAAAGCGTTCTCATCTTGCAAAGCTGAAAAATGAAAA
TCCATAGTAAGGGAAAACAATTTCAGTTTATGTACTACACAATTATATAGAGTTCACACA
ATTGACCATTCCTTAGGTTGGTTATACCCAATCTCAAAAGCCGCCATAACCTTTGCGCAT
TGGAATGTGTTCAATCGTCAAAAGAAAAATTAGCCCTGGGCATGTGGGTATTCGGGTCGG
GT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003075.7
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved