Arabidopsis_thaliana Locus AT5G01350
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana AT5G01350
Arabidopsis_thaliana
AT5G01350
5
SnoR112, AT5G00760
1616..1734, 1980..2054
3970
gttctattgggcaccgtatatcgtcgaatcaaacacagatatacctgtgatttcggatc
caaagaaacggatagtgaaagtggactcagtgaaagatcgagctaagttttgggaaggag
ctgatattttggttttcaacacttatgtttggtggatgagtggtctccgcatgaaagctc
tgtggggttctttcggaaatggagagagtggtgcagaggcactagacacacaagtggctt
acaggctaggactcaagacatgggctaattgggtagactccaccgttgaccctaataaga
ccagagtcttcttcaccaccatgtctcctactcatactaggtaaacatttagttttatta
tatgttttgatgtgtttggtttgtgattaacgtaaagtgttatgtaaaacgttcagaagt
gcggattggggaaagccaaacggcacgaagtgtttcaacgagacgaaaccgataaaagat
aagaagttttggggaacaggctctaacaagcagatgatgaaagtagtgtcaagcgtgata
aagcacatgactacgcatgtgacagtcatcaacatcacgcagctctctgagtatcgcatc
gacgctcacacatcagtttacaccgagacaggtggcaagatcctaaccgctgagcagagg
gctgatccaatgcatcacgctgattgtatacattggtgtttacctggactacccgataca
tggaatcggatcctattggctcatttgtaaatcaagctaggaggaagctgagggttaaac
gggaaaaacccaaatcctctgtttttctcctcttgtgttgtcggagatttgtttgtttca
gtgtattgtgattgtcgtcaattttcataagatcaaacagactcggcccgtttattatat
gaccttgaagtgactaaaacaaaagtaataatattacaaggcctagatgggcctggcccg
tctctggcctatttgtaaatagagggagaaacaagggtaaaataggaattccagaactaa
gagtttttaggttaatgttgactagtgggtaatatgaaccgttcgattttgttacagaac
atcgtgaccgtccgatgagagacctaagacaaattacgcaaaaactcattcgccgtcacg
aggaagatgcgaggtctatataatggacaaatctggtataatgtaaaatagggacttgac
gcagatcttgttgggtctcgaaccttcctcttcgtttgcatcaggtaaggccgattctct
tgcttatacgatctcttgattcatctgaggttttatcaattgttgtttgattttgtttgt
aaagctgtgatttttcgagtttctgtctcttattttcctgttggatttagttttctctag
aaattgttgcgatttggtggataattattgacattagggtttcgtttttgataggaaaga
gcgagaatggcgggaggaggaaactttattgcgagagtgatctcatacgttgcgaacgag
ttcatagttaatggtttggcaaacaggtactttcattccttataacgatttagggtttgt
actttttaatgatgaattgggtagatatcaaaaagtaagcttctttctctggctgattgg
attggaaatatgttccttatcggctcgttcaatattgaagcaagattaatctcaacttca
gctggtttgctacgtaatttaccatacgctgcagcgtaggaagtttgagacacttttttt
ttttctttgtgataaaaaaaaagtttggctttagttttggaattgttatagtttaggttc
tacattttttggtgtttgcaatttgtacatttctttttggctttgcgcaaagctattcgc
tgatttttaagtgaacattttgtcctgagttttattcaaatttgtttttagataactcag
gttttactttgtttaggattgtcggtttttcattatgttgttttttggggtgtggattac
tgccggtgatgattttcgtaggcttgtcctgattaaagacatgacgttaaacgtgaagct
aagagactgaggctgtttattgttttgtttttgtttgattcctttttatttgtctgattg
ataagattctttagtagtcttagtgactccctggacattcgctaatggatgtctaattgt
ttatattctgttatggcagccatgctttccagagatttgctgtgaggacttcaaagagaa
tagaaaacctctctaaaatgggttagcatcttcatactttagctcaataatgattggtct
gcttgttgtaacccacaatcttattaaaaagtggatgtttgttttccagctgcagagaac
agggagaaagtcgctcagcaaatggaagaatttgccaagaacattgacgtgagtttttat
gcatacaatctttcattgattctacaaaacatatattgacatttaagactaaacaacttt
gctttttttttgcagtccacgaagaaaccctgatcattctagtgtggaatcttaaaacct
cagtaaatcacatgggtcagctcaagtagggaggtctgtttatctttgtataaagaatgt
taaaaagtaataagcttgtggattaaacaaccagtgatcttttggtgctgtttctcttct
cttaaacccaactcttccggagtgactaaccactgtatgaaggaatttctatcgtctttt
gcttcctacttatttgtagagcacatttattgattcttttcgttttgggctgtggctttg
attttaaatatgtaaattacgggcccgttttgaaacagacttgtggtgctgtggatgtct
cttgtgtatagaattaatgtctataatcgtttctgtatcggcccaatagtccaatcatct
actgtccaatcggcccaatatactaatataggatataataggattcgattaaagtcaaat
atgtttttcacagctcttatttatttaggacaatgcatttctttttcccaaagcttaatc
actctttcctaaactctccactcatgcttccattgttatatactactgtctcccagagct
aacacaatagtgtctcatttgaacataagcatatattcatatcagctctagaaaaacaaa
aattgaataataaaatctggaacccgagtgtcgtcaaaattgtccctagaaaaagaaaaa
agaaacgcgtaacaacaacattctaaaccaaagaagaggacaaagcgaaaaaggcaatga
aaagggtaataatcaatggctattggccttgcgaaactaaaaacaatgaccaagcatagt
catttggttaggcatttacgaccgttgaataagacatcaaatcaaagatggtccctttta
ataagaggcccaaatcacatctaccatttttatggtgatgaaatcgatttacgccaaact
taccttggttgttgaaacttgaaaggtgtttgatcactactatcgtggtttgaagatgta
aaagtattttcattttttgattgaatatgcatatttattttaaataaaacccactattat
gagaatattgtgccaatgacatctctaaaagaaaaaaaaaaaggtcactttctttctcac
actttaaggatacaacaaacaatctcaatttctttttgttatctttttctttctttctaa
agcaaacatttttggaaaataacaaaagaataaatagcagagagtctgtaacgagaagaa
ggacgaatatctctctctctctttctctctgcttccttctcgatttctgattcgctcacc
ggccgaggaatcagatatggcgacgagaacggaatcgaagaagcagattccgccgtacat
gaaagcagtctcaggctcactaggcggagtggtcgaggcttgttgtctccaaccaatcga
cgtaatcaaaacgcgtctccagctagatcgcgtcggcgcttacaaaggaatcgctcactg
tggttcgaagg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1243, 1434..1525, 2179..2240, 2329..2387, 2475..2970
1446..1525, 2179..2240, 2329..2387, 2475..2492
NC_003076.8
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved