Arabidopsis_thaliana Locus Mono:SnoR105
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR105
Arabidopsis_thaliana
Mono:SnoR105
1
SnoR105
1001..1107
2107
CCTTTTTTTTAAACATCTTTTTAGGTGACTTTCACATCATGTGTCAGATAACTCTTATT
TATAATGTAAATTTGAAATAATAATATTATTATATATTAGAAACTATCATATGAATATAT
AGACTATATATAATTTCCAACGGTTATGAGAAACCGTTTTCTCTTAAAATGCAATCCCCA
AGGACAAGTTTGTTGGCGTGTCGGGATAACCAACAATCTGTTGGATTTGATCACTTTTGG
ATAATCTGTTTTTGGTGGGTTTTCTTTTCTCTTCATTCGATGGAATGTGTGTCACTAGTC
TGGTTGCACTTTTCATCAGTTTTAAAGTGCATTTTGGTGGTTGGATAAGTTTGGAAAAAT
TACAGATATTTTCCATGTAATATGATGGATAGAATTCACTATATAAAAAAAAAAAAAATC
GCGTGTTTGGACTTTAGCTGAGTTTAGTTGTGTTTTGCTCAATGTAAACATATATCAACC
ATTTCACGAACATCAATATGCAATAGAAATGGAATTCTCATGCCATCTCGTCCTAAGATC
CTACTCACGGCTTTTACTAGCTACTAGCTAGTCCATCACATCATACACCTTTTAAACATA
ATAACGTATGTGAATTATGTTATGACCGGAGACTTTCCTTCCTATGAAGAGTTTGATGAG
TAGAGGAGTGACACGGATCGAATATTTGATAAATAGCTCATTCATCTAGATAGGTTTAAA
ACTTTAGACTATTACATTGTAGACAAAAAAAAAAAAAAAAAAAAAAAAGGATACAGAGGC
CTTTTATCGGCCCACCTTAAAAAAAGAGAGCTACAGAGGCCTTTTATAGACCCACTTTAA
AAAACAAAGATATATGAATTTGAGATAAGAAACCTTATTTCAAACAAGAGAATAGTTTAT
TTTGTCCCACATCGTTTAGGTAGAGATAGTGATGGTAGTAACATGCCTATAAAAAAGAAA
GAGCTAATTACGTAAAAGGCATGATCCTTCAGGCAAGTTAAAGGGGATATGATGAATGGT
AAAAACTCGCTTATATTGCGAGAAGAGCGTTCCGCCCAAAGCCTGTTACGACTATTGGGC
GCTCTCTTTTTTACACAATCTGATCCCTCCCTAATTTCCAATAAGAAGGAACTTTTCTTT
TTTAGTTTTGGTTTCATTTTTCTTAACTAGTTTGTTTTTGGTGCAGTTTTCTTTTTAAGG
GGAATATAATTTAGGGTTAGTACTTAAAAGTAATTGTTAGGTTGAAATAAAACTAGTAAA
TGAAAGTAAAATCCTTCAGGGATTGAACCCCAAACTATATACATCAACTTTCAGCAACCA
TTAACACTACTTGGAATCTGAACAATTCTTACACACCAGAATTATCCTGGTGGCCAGAAG
AGATCTTTAAGTAATTATGGCTTTGAAGTTGAGACTTCGAGTAGTAACAAATTCAATGAA
GCAAGTAGTATAGTAGTACATGTGATGAATTCCAAGAACATTGATTTATAAACGAATCAA
GGATGCAAGAGAGTTAAAACGCAGAAAAGAGCTCAACGAACCATGTTTCTCATTGTATCT
TCTGGTGGAAAAAAAGCACATGAAACAAGATTACAGATAGAGTGAAGAGAGAAACAAACT
TCAAGCCCGTTTGCCGCTGCTAGGGTTGGACTTGGGACAGAGGTTCCAACGTCCCTTGGC
ACGTCGACGCTTTATGGTTGCTCTACCGCTAGTGGTCCTCATCCTTCTACGGAAACCATG
AGTCCTAGCTAGAGATTTTCTTGATCTGCTTCTCTTAGTTTGACACAGAGCAGCTTTTCC
AGCTCTAACCACAAGGCCTCTGCGTCTCTGGCCATTCAGTCCACTAGTTTGACTGCTGAG
ATCAAACGCAATGGACAAACCTGAAAAGACAGCAACACCATTTTGATCAATGTGACATTA
TAGGTTTGATAGTGTATCAAGCTGATAATATTGGAACCGGTAAACTCCTTCCTTTAATTA
CCCAAAGAACTCACCATACAATACCAAACTCTCAACACACTGCTCAGAATCAAGACCCAG
ACAAATCCAAAATGACTTTAATGCATTCTCCTAGGTTACCCTTTTAACTCTTGAGCTATA
ACCATAAC
  Untranslated Region
  Coding Sequence
  snoRNA
CP002684.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved