Arabidopsis_thaliana Locus Mono:SnoR101
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR101
Arabidopsis_thaliana
Mono:SnoR101
1
SnoR101
1001..1068
2068
TAGAAGCGATAATTGAAAATTCATCATCTAAACAGATCGATACAAATACAAAATTCGAG
ATAGATGCTACAGAAACTAAGCCAGTCAAGCATAAATCGCAATCATCCAGAACATGATAT
TCAAATTTCGAAACGTAGAATTCGATATGAATAGCCAAAAACTATCACCAAAACAGATCG
TAACACAAAAACGAGATTCAAACAGCAAAATCAAAGAAGAAAAACGAAGAAAAATTACCT
TAGGGACGAAAAGAGAGAGAGAGAAGAAGGAATTTGTGATTGATCGCTTTGTGGGAGATT
CAAGTGAGAGGCCAAGAGAAGAAGAGAGAAGGGCTTAGTGGAGAAAGGCTTGTAAAATAT
CTTCGGTCAATCAATAAAGGATATTGCAAAAAAATTGAAATTTCGCACGAAATGTAAAAA
CTGAGGGGTTTAGGCGGGATTTCAAATATATTTTGCCAGGTCATCAATCCTTGTGGTTTC
ACATCATTGGCCGTTGTCATCTCAAGTTTTGATTCTAGGCCTTTGGTTATGTGTTTTCTC
TTGTGCTTCTTCTCAGCGTGAGAATTCAGCGGCAAGCGATATGACTCATTGCCCTTATTT
TTGGTCCTAAATAATTAATTTAAAATCATAGCAGTAATTACGGAAATAATTATTCGCATT
CAATCCCTTCAAGGATCCGGTTCGGTTTGCTGCGTCGGCCATCCGGTTCGGTTTGGATTT
ATTAATTTTGCTAGGGCTTCTGATTTTAAAATGTTCGGTTTGGGTGAAATTGCTGTGGTA
TATATGAGGAGCTCCTGCATCGCCGCCATAACTAAGGATAACATTTTGATCTTTTTATCG
TCCATGGATCCTCTTGCTTTGCTTTGTAGTCTTTATATGTTTGTTCGATTAGATTAAGGT
TTTTTGCCGTTTGTGTAGTGTTATTGCTTGAATTGATTACAGTCTTTTCTGAGTTAGGAT
TAGATAACTTATGGTGCAAAGAGAGAGGGAGAGCAAATGATGGGATACACTTGATCTCTG
AACTTCACAGGTAAGTTCGCTTGTTGATAACTACTGGTCTGCTGATGCTCTCTTTCTCAC
ACTCTCTGCTCCTGATTGGGATTTTTATTAATGAGATTTGATTATGTAAGACGTTACTGT
GATTAAGTGTAGTAGAATTTGATGTGTAGTTTAAACATTAGTAATGATTGATTTTATTAT
ATATGAAGTTAATCATAATGCCTTGGAACATGATCTTTAGAAAATGCATCAATAATGTTT
GGATGAAATGCTTAATCCATCTACCCCGCAAAGCTAAGGATAATGACCGGATGGGTAAGT
CGTTCTGAAGATTGTTTGACTAGTCATCTTTGTGAGTCTCTTTTACTGGTTCAAGGAATC
AGTTAGAAAGAGATGAGCAAGGGAGTAGGATGATTAAGAATAATAAATTGACTCAAAATA
ATCAAACAATGAGATAGTTTACCTGGTTGTATCATTTCCATAATTGTAGTTAGATAGGAA
AGGCGTTGGTCATCAGAAGGTACAAGCACCTTTGTCTGCTCGTCATCCTCAATAGAGAAA
AAGGAGGGCTTAAACTTGTAGAAGTCTTGGGACCAACATTTGGCCGTCTCAAAAACTCCC
CAACTGTCAGCTTCCATGTCGTACACATGAAGCTCAATGTCACTAGAACGTATCATTTTC
TCCCTCACCACTAGACACTTGCCGTCATATGCAACCACGTTCCAACATTCAAGATCTGAT
TCCTCCATTGATACGTTCTTGAACTGGCTTGCGAGTGTCCACTTGTGATACCCGAGTAGT
GTGTAAACTGAGATTGCTTTTTTCGTCCCTGATATCAATGTCAGGAGATTGGTCTCATCG
TTTGCTGCGAAAAGCACCTTCGTATCCGGTGTTGGATGGAAGCTACAAGGAATCAGTCGT
GCTTGCTCTGTCTCGGGATTGAACGCTATGATGCTCCAGTCGTTTCTCAACCAGTGAAGA
TTGCCATCTACGTAAACAGGTTTCATCCGCTTCTTGAGACCACTTTTGGAGCTGGTCGTG
AGGGTCGTTTTCGATAACCTCCAAGAATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved