Arabidopsis_thaliana Locus Mono:SnoR102-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR102-2
Arabidopsis_thaliana
Mono:SnoR102-2
1
SnoR102-2
1001..1158
2158
catgaccaaatatggagtggtaagacattgaatatcttgcattgccgagaaatttgatg
gaacgaatcaagtatatgattgatctgagaggaaaaactttgatgaatacaagaacttat
atataagcgaaaaaggctgcacaaggggaggcagcaacgagagcttgacttgcattacgg
ttcctaatcaacaagagaaccaaggtccaacgaataatagtaagaggtaacaagatctct
tatcatgacattataatcataaactatgaaagctcaatcttaatgactgagagaagatgc
atttttttttgtcagagaaagggaagatgggtttcttcttcacagagttagcttctcaga
gtttgtaagtcccctagtttctttcttgtgttaagatatgtttatcaagaccaagaaaaa
cataagaaaaaagggaaataacgtcttctttattttaccatatacaggttacttatacta
tcaactcatcaggagaagtcattgacacaaaattagttaagcagaaaggcaaagagacca
tctaaggtttcattactccattgctgtgaagcgcacaaacattttgtattcttcgcttaa
tgaccgaaataccctttgagtggtctgagtctcagttgaatcgtcagagggtaaaactgg
aaatttgattctataagtttcacccaaaaaaaaggaatgacctttagggttttgtattgg
atttggtctctctcatcattagtttaagtatgaggttctgctcccggaggattttttctt
ccggtggaagcggagccgatgatttcaaatctctcttgacgaaccactttttaaagtggt
gatgaatcatccaatcatctcctccgtcaccaccactgccactactactgagcttcctcg
attaaagattctactttacttggatctctatcttcttcttcttctttgtttttcggttaa
gctctcttcttcttcttcttcttcttcttattgggagacaaTGATGATTCTTAAGAAGTC
AATAAACCAGACATTGTGGTAACACTCTTCTTTCATGGCGGGGCTATAAGGAAAAAAGAG
AACTCCTTTTTTTCTTTGTAAGCAGCCATGGCTGAAGAGTTAATCCTCTAATTTGTCTGA
GAAAAGGCGAATCTGAGTCctttcctgtgacatgcaaatattttatcagaatccttttaa
aagtgtttataagctaaagttttgatgcatcgttttgtagtagaatctaagttttttgag
ttgtgaaaatgggacaaagatagagatttctattaaattgatgatcttgtcttaaagagt
tcttctggttcaagtgttgtcacaccagtgtttcatctatcattaaaatcatatatggat
gtgaagaatggggatatgattattgtcagatgatgattgccgagaaaagatatcagattc
taaacccaaacaagatacaattaaaaaggtcataagaaacgaaagtggaaattgtgcttc
tagttaatctacaaaagtccacttttgttttggacccaaattctagattgaatgaaacac
aagatcgatgaccagccagtagattaccaaaacaaaagtcctaatttaacctgagaagaa
acgcagattttaaattaggacttttgttttggtattctacactctttcgatacaggaagg
tgtaatttctgaatcaaatgaaaaagtacatacagtgccatttaggaaaaaacaattaaa
agggtcaaattgtaaatttaaacgaactgtgtgaaacaaaaagaaagtgtagcgcctttt
tggaaaggaaaaagattatggaacccaaaagtgtaaaatcgtaagagtgattacgtgaga
aatgtaccaccgacatctgaaccggggggactcatcaaaacgtggtcgttttattgtagt
ttctccgcgtttggtacatcaacacttgtagctgtgtatctttctaattcttcctttctt
tcgctgacagtgcttgctcacacactaatcgcaattgttgctgcattgccgactctgatt
cgttcgatttcagcattttgttcttccgaagcgatgcctcgtcgatccggagattgcatg
agatgtctggtgattttcgcggttgtatcagctttagttgtgtgtggacctgctcttta
  Untranslated Region
  Coding Sequence
  snoRNA
CP002687.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved