Arabidopsis_thaliana Locus EMB2757/TAN
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana EMB2757/TAN
Arabidopsis_thaliana
EMB2757/TAN
4
SnoR107
1177..1364
6099
TCCAACAAACCAAACTTCAAAAATCTCTACTTTATTGTTTGTGTTGTCATATAACTGTT
ACAGAAAATTTCCCATTATCTTCTTCAACGCAAAATTCAACAATAATGCAAGTGCAGATA
CTAACATTCAAAGCTAAATTCTCATTATCAAACAAGAAACACATAAGCTTTAGCAAACAA
ACAAAACAAAAAGTCACATTTTTTCTAATGATCGATCTTATACTAAAGATCCAATTACAG
AATTGAAGCCAAAAGTGATCTAACCCTCTAACGGAGATAACCAGGGATCTTAATGCGAAT
GAAGAGCATACTCATAACATAAGCAATCACAATGGAGGAGACTCCAGCTGTTGCATAAGA
TGCTTTAACACTCTTAGCTCGATTCTTATCCAATGCCAGATCCAACATTATGATTCCAAT
CCCACCGAGTACGAACATGAATCCGGAAGAAAGACCTTCAATGATGTATTGACCATTGAC
CCGACCCGACATAAACACGACGGGTCTTACTGACCCGGTGATTGGATCCTGTGTCGATCC
GATACCTGGAGGCTCGACAATCACGTCGTAGACGAAACCGGAGACGACGAGGAAGTAAGT
GAGGAGAATCAGTGAGAAGACAGTCATTGGAGATGGGAGAGTGAAGGAAGGGAGCTTGAG
ACGAAGACGTGGTGGTCGGAGGAAGGAGAAAGGGATGATACGGAGAATGTGGAAGATCGG
ATCGATTGAGGATTCATTTTCGTCGGAGCCGGTGGCTAGGGTTTGTGAATCTGATCTCGG
AGCCATTTTCGTCGGATTCTTCAGCAATTAGCTCTTCGTTCTCTTATTATGTGAGTGAAA
CAGTTTCAGAGTTGGTTTGTTTGGAAACTTGGATATTGTTATCCGCTATATGAATACATT
TGCACATTGTGCCGTTTTAGAAAAAAGTTAATATTAAACGACACGTAGTTTTTGATATAA
GGGAGAGTTTCAAAGGCTTTCTCTTTCTCGGTGTTCCTGTTGTTAAAGTCTGAGACTTGG
ATTCGATTAAGTTGTGTGTTCGCTTGGTTTCTCTATTACAAGAGTTTGGTTTTGTGTAGT
AGTTGAATCAGAGATGAGTAAGAGACCTCCGCCTGATCCAGTGGCTGTGCTTAGAGGGCA
CCGTCACTCTGTTATGGATGTTTCCTTCCATCCATCAAAATCTCTGCTTTTCACTGGGTA
TATATTAATTAGTCGTCTCTCTCACTTGTGAGAAATTCTCGAGTCATTTATTGTTTTTAT
TTATGATGATTTGGTGCAAAATTGAAGCTTTGTTTCTCCAGTTCAGCTGATGGAGAGTTG
AGGATTTGGGATACTATTCAGCACCGTGCAGTTTCTTCTGCTTGGTTTGTGATTTTTGAT
TTTTTTAATTCTTTGTTTTTGTGATCATTATAAAGTAGCTAGCACTCATTGTATCTATTG
GGATTTGTAGGGCTCATAGTAGAGCAAATGGGGTTTTAGCTGTAGCAGCTAGTCCCTGGT
TAGGAGAGGACAAGATTATCAGGTAAAAACGTAAGCAATCATGCTTTCATAATCAATCTA
TATACGGAAAATCTGAGCTAGTTACTCTGATGGTTATAGCCAGGGAAGAGATGGAACTGT
TAAGTGTTGGGATATTGAAGATGGTGGTCTATCAAGGTGAATATGATCTCCCCCTTATTC
GACTTTTTATGCGTTTGTTTCTATCGAACTATAAGTCTATAACCAATGATTCTTGTGACA
TACTTGGCAGAGACCCATTACTAATACTTGAGACATGCGCCTATCATTTTTGCAAGTTCT
CTCTTGTTAAGAAGCCTAAGAATTCTCTGCAAGAAGCTGAAAGTCACTCACGGGGTTGTG
ATGAGCAGGATGGTGGAGACACATGTAATGTTCAAATTGCTGATGATAGTGAACGATCTG
AGGAGGATTCTGGTTTGCTTCAGGGTATGTTTTACTTGCGTTGTCTAAAGATTTTGTTAG
CAAAATAACTGTTTTTCTTCTTATTGCTCATATTACAAAAAAATTTAGCAGATAAAGATC
ATGCTGAAGGTACCACTTTTGTAGCAGTAGTAGGGGAGCAACCTACTGAGGTGACTAGAA
ATTCATATATGTTTTGTTTTGGAAAAGTCATAAAATTGTTTCTTCTCTCCTCTTTTATTG
GTTTTCATTTCCTGTGTTTCATTCTTGTGATTTGGTCTATCCATAAAGGTAGAGATATGG
GATCTCAATACCGGAGACAAGATAATACAGCTTCCTCAAAGTAGCCCTGACGAATCCCCC
AATGCTTCTACCAAAGGAAGAGGTGAGCTCATATTTGTCTTTCAGTGAGATCCTTCATAT
GTACATTTTCTTGTTAAAATTGATGTTTTTTAGCATCAGTAAAAAATTTCAAATTAGTTC
ACCTTTGAACTTGCTTAAAATACTTTCATCAAGGTCGTATATATGGTCATCTGCAGGAAT
GTGTATGGCTGTTCAATTGTTTTGCCCTCCTGAATCACAGGGTTTCTTACATGTCTTAGC
TGGGTATGCTCTCTTTCCTAAGCTCTTTTCCATTAATCAAGAAAGACAAATCTCAAGATT
ACATACTTTGTTTTTATAATGGGTGGTTCATTCCAAACTTGCGCAGTTATGAGGATGGTT
CAATACTTCTTTGGGATATACGCAATGCTAAGATTCCTCTAACAAGTGTGAAGTTTCATT
CAGAGCCAGGTCTTGTTTCCATCCTCTGTATTTAGATTTTTCTTATATTTTGTTCCTGCT
CTCTGAATTTTCCAAATTACTTAATTCGTATTCTTTATGCAGTTTTAAGTCTTAGTGTTG
CATCATCATGTGATGGAGGAATCTCAGGAGGGGCAGATGACAAAATTGTGATGTATAATC
TCAACCATTCAACTGTAAGTTTGACATCTGCTAGAGAGGATGCACTTGTGTGATTGCCGT
AAAGCTATAGTTTAATACTGATTCCATGACATTTTTTCATATGATTGTAGGGTTCTTGTA
CAATAAGGAAAGAGATTACTTTGGAAAGGCCCGGTGTATCGGGCACCTCAATTCGAGTCG
ATGGGAAAATTGCAGCCACGGCTGGTTGGGACCACAGGTTAGCATCCTCATGCTATGCAC
TGATTTTCACAATATGAAACAAAACATATGAATAAATCAATTAGACTTCGTCCAGTGTGA
AAAAAAGTTGATGCATATGACTAAAAACTATTCTCCTGTTTGTTACATATTTGGAAACAG
AATACGAGTCTATAATTACCGCAAAGGAAATGCTCTAGCAATACTAAAGTACCACCGAGC
AACGGTATGTGAAAATTTCTTAGACTGGTTCAACAGTTGAGAGACAACCATTTTCTAAAT
CTTTGTATTTTGATGCCTTCATGTGTTTTGTTTGCAGTGCAACGCTGTGTCCTACTCTCC
AGACTGTGAGCTAATGGCGTCTGCGTCTGAAGATGCAACTGTTGCTCTCTGGAAACTATA
TCCTCCCCATAAATCTCTCTGATCTTTATGGTTCGGTTTTGGTTTGATTTCTTGACCTGA
ATCTCTTGAATTGGTAAATATACATGATGTCATCATCAAAAAAACAAATGGAAAAACAGA
GAGTATTTTCTGGTTTGTTATATATAGCCCACTGATTAGTTTGATTTGTTCAAACTCGCA
CGTTCTGCCGTTTTCGGAGAAAAGAATAATCAAACGACGCGTAGTTTGAATCATAGTACG
TTGAGTAGATTTCACGACCAAAAGAAATTGCATTTGCACCAAACTAATCCGTCACCGTCG
TAGGAGACTCATAACATCTGAAGACCTAAAATTCAAACAGTACGATTTCATCTTTCTCGA
GCTCTAGATCAATCGTCATTCTGCTTTCTTCTAGATCGGTCCTGATTGTTTCCCATTGAT
CTTTGATCCGGAAGCTGTGTAAAATGGCGTACGTCGACCATGCGTTCTCGATAACGGACG
AGGACATTATGATTGAGACTTCATACACCGTCAATAACCGACCGCCGGTGAAGGAGATCG
CACTCGCGGTGGCTTTACTCGTGTTCGGAACCCTAGGAATTGTCTCCGGTTTCTTCATGG
CTTATAATCGAGTTGGCGGTGATCGAGGCCACGGTAGCGATTTCTTCACCTTTCTTACTT
ATTCCACATTTATTGATCCAGTCTTGGAGTAGAAATTGGGAATTCATGAGAGAATATGTG
GGACTTATCTTTGCTAGTTTGAGAGATTTAGAAAACAGTAATTGATTTCAGCTAGATTGT
TTTAGGAATTTTTTTAGATTTGGTGAAGTTATGTTATAATTTTGGTAATTAAGCTGATAG
ATATAGATTGCAAGTGCTCTGGTTAGCTACGGTGGAGTGTAATTTCGTTTCAGCTTGGCC
TTTTGCTCTCTGTTTTCTGGAGATTTGGATGAATAGACACAAGTTTTCCAAAGGCATACG
ATTTGATTTCATTGTTAGAATGATTAGTAAACTTCCGATAGAAACTAGTATATGATGATT
CTAAGCTTCTCTTATCTGTGAGATAAAAAAGGGAAGGATCTCCGTTGGATTCCATTAACT
TTTTAGATCACTATCATCACATACTGTTATTGATATATCCCAATTCTGCTTGTAACATAG
ACATGAGATTCACTTCAAATTAGCTAGTTTGCTCTTCTTCCTCTGGGCTTGTAATTCATT
AATGCATTTCATACATCCCCAATGCAATACTGCAAAGCGAAAGCAAGTATCAGCATTGTA
CTTAAACTTGATTTCATTTGATTTGCTGTTTTCTTCCGTTTTGCCGGAACTACTTCTTTC
TCATCATTGCATCAATGACCTATCATTCTCTGTTTGATATTTTTGATGGTGAAACCAGGG
ATTTTCTTCATCGTCCTCGGGTGTCTTCTGTTCATTCCCGGGTTTTACTATACACGGATT
GCGTATTATGCTTACAAAGGATACAAAGGTTTCTCCTTCTCAAACATACCGCCCGTTTAG
GTGTCCCCTTTTGAATCTCTCCTACTCAAAATGTATAGAGATGTTTTATTACTCTATAGC
AATGATTGACTTGTTTTCTCTTTTGTGTAGTTTTATAGAATTTGAGTCCAGTCCTTTCTT
ACTTTCTCCTTCTTCTTGTCAAATAAATTCGAGTCTGTGACAGTTTAGTCAGATTTATAC
TTACATATCTATAAATATACACCCGGTTCAAATTGATATTTGTTTCTATAAAGATTTCCA
ATTCGAACCAAGTAATATGGGATACTTGGAGTGTTCACATGTTGCTTTCAGATGTAATTG
TTCATTTTCCATCAAATTCCTCTGGATGCAGTATTTAATTGATTACAAATTTGGCCAACT
TACACATTGTTACTACTAGAGTTTCAATCTATATCATGATGGTGTATTGGTGTTATATCA
AAATTAAAACGTGATTCTTATGTGAATTTTTATGTTCAACATTATTGTTTTCTTTGGGTC
AAATGTAACCTTTTATCTTTTTGTCATCAACATGAATGTTCCTTATAACATGCACTTTAT
TAGCCTGTTTAAAGCAAAACGTGACAAAACATAAATATTCAATTGCTATATACGGAAAGC
GATCCAGATATTTGAATGATTAATGGGCCCAAAATATCTCTCTACGTCACATACATAATC
CCAATTAACCTAAAAGCTTAAACCGACTAGCCGGTTCTAAGACATTTCCGGTTTAAGTAT
CTGAATATAGTTTTCTCTCTCTCTCACTCGTGTCCTCTCCTCAAAATCCTCAGCCGCATC
TCACTTCTCATTCTCTAGAAAAAATGGCTTCGTCTTGTCTCTTCAATGCCTCTGTATCGT
CCTTAAACCCTAAACAAGACCCCATCCGCCGCCACCGGTCAACCTCTCTCCTCCGCCACC
GCCCCGTCGTCATCTCCTGTACCGCCGATGGCAACAACATCAAAGCCCCGATCGAGACAG
CGGTCAAGCCTCCTCACCGTACCGAGGATAACATTCGAGATGAGGCTCGTCGTAATCGTT
CCAACGCCGTGAATCCATTTTCAGCTAAATACGTTCCGTTTAATGCAGCTCCTGGATCCA
CGGAGTCTTACTCTCTCGACGAGATCGTGTACCGTAGCCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1196, 1301..1363, 1450..1521, 1599..1655, 1750..1943, 2031..2089, 2208..2301, 2456..2522, 2626..2708, 2802..2893, 2990..3096, 3240..3303, 3397..3818, 3914..4112, 4858..5099
1093..1196, 1301..1363, 1450..1521, 1599..1655, 1750..1943, 2031..2089, 2208..2301, 2456..2522, 2626..2708, 2802..2893, 2990..3096, 3240..3303, 3397..3501
NC_003075.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved