Arabidopsis_thaliana Locus eukaryotic translation initiation factor 4F, putative
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana eukaryotic translation initiation factor 4F, putative
Arabidopsis_thaliana
eukaryotic translation initiation factor 4F, putative
23455724-23462007
SnoR103
1804..1909
6284
AGTCATTGCTCAAGTTTAAAAGAAGAACTTGGTCACATAGCCACTGCCTCCGTTTGCGT
GTATTTGAAAGTTATAAGCTTGTCACCATCTTCTTTTTTGGTTGTTCAGGTTGAGAATGA
TGCAGTTGTGGCTTTGACTTTGAAGAAAGGTTATACCTTAGATCCTCTTATTCTGAAATT
TTCAATTCCTTGTTGAAATGTCGTAATGGATCATGCATCTTGGTTAATTACTTATCACAC
TTCATCTTTCTATATGTTATTTGGTATATGAACCCTTCAAACTCCATTGACTTCAATTGA
GCCTGTTATTGTGAATCTTAGTTATTTTGTTATCACTGGATAATCTTTTGGTATGTTTAA
GAGTCTTGCCTAACTTTTGTGACCGTGATATAGCTGAATGTGATTCCTAATCTTATTATT
CTTTTAGCCTTGTTTCGATTACACAACTGTTGAGGATGCTGTATTGCATTCTGAATCTAT
ACAGCTATGAACGGCATAATGATTGCATTGCATCTCTTTTTTCCATGTGCAGATGATAAC
GAGTTTGAGGATGTCAACATTGCACAGCCCACCGACTTCTCACTTTCATGAAGAGTTGCT
TACTGTATCAAGGAAACTTCAGGAGAAGGTATTGATTCAAAACACAAGGAGGAGTCTATA
AACGCCAGAAGTTGTTTCTTTTGCGTCTCTGCTTGTGTTAACGCCTCTTTAGTTTGTTAC
AGACAATTGTTGTAAGTAAAGATATTGAGATGTGGAAGTTTGATTGCAACTTGCCAGATT
AGTAGTTTTTACAGTCTCTTAATATGTTTACAATGAGCTAGAGGTGCAGCTAACACGAGC
CGAGGAAGCTCCATTATTACCATTTGACATTGTTCATTGACGGAAAACCCAATGAGGGTG
ACAAAATAAAGAGACAAAAAAACAAAATGAAAGGACATAACTGTAATCTTAACGGAAAAA
AACGTTAAGGCTATAAGTGTGTCTGGTTCGGGAAAAAGAGAGGAAAAAAACCCTAATAAA
GAGAAGGGATTGTGTCTCCTTCTCGACTTCTTCTTCTTCTTCTCATTTCTCAATCTCAAC
TTTTCTCTTCTCTTCTCTTCTTCGCTAACGGCAGGAGAGAGAGAGACCCAGAAATCCGAT
CCCTCCTCTCCTTGGATTATCGGAGTCAGCGATTCATCGTCGCTGATAAAGCTTCTACCT
TTCTCTTCGATTTTTGTTGTGAGATTCGATTCGATCTTAAGGCGGATTAGATCGAGGTAT
GCAGCAAGGCGATCAAACGGTTCTGAGCTTGAGACCTGGTGGCGGTCGAGGAAACAGACT
ATTTGGTTCCTCTTCTTCTTCTTCGTCTCTCTCTTTTGGCTCTCTTTCATCTTCGGATCT
ACCTCTCCTTCGTCCTCATGGTGGTGCTCCTGCTTCCTCTTTTCCCTTCAAGGTACCCTC
ATTTCTGGGTCCCCTCTCTAAATTTGGATCTAACTCCCTCTTCTTCCTCTGATTTAGAAT
TTGTTTTATCTCTCTTGTCTTAGCTTGAGCTAAAAATTTATCCTTTTTTACGGGTTTGTC
GCAATCAGCAGCCTTTTTGTTTGGAATTATAATCTTTGGTATATTGCTGATTTGATTCTC
TCAAATGTCTGAATTGGCTAATATCTTTCTGATTTGCGAGTTTTAATGCTTTGTGTTTGT
AATAACTACTGAGCTCATGTTGGATTTTGATAGGTGTCTGCAACATACATAATTGAACTT
CATAGGTTTATATGTCAATACGAGTAATGCAAGCAGTTTGTTTGTCCTGATTCTTAGTGG
CGCACGCAAGTATGTGTTTCTGCTGTAAATATGGACGTATAATGATATGTAGGCTTTTAG
GTGGGCATTTTGTTAGCTGCTATTTGCTCATAAAGGACCTACTGACATTTCTTCTAGTTT
TTCTTTAGTTCATCACTCATTTCGGCCTTATGGTTAAAGAATTATTCCTCTCTTTCTTTT
GTACTGAGTACTCGTGGTTCCTTGTCTCCTTTATACGTTATTTCTTATATGATTTTGTGT
ATTGGGTGTTAGTTAATGAAGATTTATCCTGGGTTGTGCTTTTGTTTCAGGGTGGAGACT
CGAGGTTCGATGGCCGTGAACGTGTGAAGTACACCCGTGAGCAGCTCCTGGAGCTTAAAG
AGGTGATTATCCCAGTTAAATAATATAGGATTAAAGCCGGTTTAGTTTCTGCTGTTCGTA
TTTGTTCTTCCTTAGTTGAGGTCATTGACGTCTGTGCATATATACAGACCACTCAACTCT
CTGATGAAATTCTGAGAGTCCAACGGGAAACTGCAGCTGAACTGTTTGGTGAGGAAGGGA
CTTGGGCACGTGGAGAAAGTGTCGTAAGCAATTTGGTATAGTTTTGTTGAAACATAAATT
TTGCATTTTGGTATAGTTTCATGAAGTTTCACTTTTAACACATATCTTTTATTTTAATGG
TTCAGGTTCCCGTTCAATCCGCAAGTCGCTTCTCTGAGCCAGACTCTCGTGATTGGCGTA
GCCGTTCTACTCAACCTCCACCCTCTGGGGAGGAAAGGTCGTGGGATAATCTTCGTGAAG
CTAAAGATTCCAGGTATGTTGAAGCAAGTCAATATAATCGTCAAGACCAACCTAATTCCC
AGTTTTCAAGGGCAAACATATCATCCAACCAAGGGGTAATTGATCAATAGATGAATGTTT
TTCCCTCTTCTTAGCCCTTTACATTCTGGCATGATTTCTTATTTTTCTTACTTATTTGTA
TATCGTGTGGAACCAGGGTGGACCAGCTCCTGTCCTCGTCAAAGCCGAAGTTCCTTGGTC
AGCTAGAAGAGGAAACCTTTCTGAAAATGATCGTGTTCTGAAGACTGTGAAAGGGTAATG
CCGTTGTGACAGTTATTAGTTGTCTAGACTTTTGTATAACTTTCCTTTACTGCCAACATG
AAATCTTTAAAATAGACTATGCACACTTACAAAGATATACTTTTCTTGTCCAGGATACTG
AACAAGCTAACCCCTGAAAAGTATGACCTTCTCAAGGGCCAACTTATTGAATCTGGCATC
ACATCTGCTGATATCCTGAAGGTGTATGCTATGTCTCAAGCATAGATGAAGTCTTGTTTG
AATCATCTAGGCTGTTTGTGTGGCTAACCCGTGTTCTTTTCTTTCATTTGTAGGGTGTGA
TTACCCTTATTTTTGACAAAGCTGTCCTTGAGCCGACCTTTTGCCCTATGTATGCAAAAT
TGTGCTCTGATATCAACGACCAGCTGCCCACCTTCCCACCTGCAGAGCCTGGGGATAAGG
AGATTACATTTAAGAGGGTTCTACTGAATATCTGTCAAGAGGCATTTGAGGGCGCTTCTC
AGTTGAGGGAGGAGCTTAGACAGATGAGTGCTCCAGATCAGGAGGCTGAGCGGAATGACA
AAGAAAAATTGTTGAAGCTCAAGACTCTAGGAAATATTCGTTTGATTGGTGAGCTTTTGA
AGCAGAAGATGGTCCCAGAAAAGATTGTTCATCACATTGTTCAGGTTAACACCTATAAGC
TTACACATTTTCTTAGACTTCTTTTATTTTGGTATCTAGCATTAACCTTTCTTAATTTGT
TCTGTGCACAGGAGCTTCTGGGGGCCGATGAGAAAGTTTGTCCAGCCGAGGAAAATGTCG
AAGCTATTTGTCATTTCTTCAAAACTATTGGCAAACAACTTGACGGAAACGTGAAGTCAA
AACGGATTAATGATGTATATTTCAAACGCCTACAGGCTCTGTCAAAGAATCCTCAGTTGG
AACTGCGTCTGAGATTCATGGTTCAGAATATCATCGACATGCGCTCCAATGGCTGGGTTC
CAAGGCGGGAAGAGGTATTCTAGGTTTTACAAGGTTGAGACTTGTTTCCTGCTCCATTGT
GTAGTGATTCTAATGTTCTATTTACATTACTCGTGCAGATGAAAGCAAGAACTATAACCG
AAATACATACTGAGGCAGAGAAGAATCTTGGTCTCCGACCAGGTGCCACTGCAAATATGA
GAAGGGGTATGGTTTCTAGTGGTGGGCCTGTGAGCCCTGGCCCTGTCTACCCTGGTGGGC
GACCTGGTGCGGGTGGCTTGATGCCTGGTATGCCTGGGACGCGAAGGATGCCTGGGATGC
CCGGAGTGGACAATGATAACTGGGAGGTACCCCGGACAAGATCAATGTCTAGACGCGATG
GGCCAGGACCTCTACATTCTCCAGCAGTGAGCAAGTCGGCCTCAATGAACACGAGGCTCT
TACCTCAAGGCAGCAGTGGCATTATGAGTGGCAAGACAAGCGCACTGTTGCAGGGAAGTG
GTTCAGTGTCGCGTCCAGTTACCGTGTCAGCAGAACGGCCAGCACAGTCAGTTGCACCTC
TGACCGTACCAGTTCCGGTGGAGAAACCACAGCCTAGTGGTCCCAAGTTGAGCGAAGAAG
TGCTCCAAAGAAAAACAAAGTCGCTTCTCGAGGAATATTTCAATGTCCGACTACTTGGTG
AAGCTCTGCAGTGTGTAGAGGAGCTTGGTTTGCCGTCATATCACCCAGAGTTTGTGAAGG
AAGCAATATCCCTGTCTCTTGAGAAAAGCCCGCCTGTCGTTGAGCCAATTGCTACACTCT
TGGAGTATTTGTTATCAAAGAAGGTAGTCGCACCCAAGGATCTTGAAACTGGGTTCTTGC
TCTACGGTGCTATGTTGGACGACATTGGAATTGATCTTCCTAAGGCACCAAACAATTTTG
GTGAGATTGTGGGAAAGCTGATTCTGGCTGGTGGTGTGGATTTCAAATTGGTTAGAGAAA
TTATAGGGAAGATGGAAGACGATAGGTTCCAGAAGATGGTGGTCGATGCAGCTGTACGCA
TTGTGGAGTCAAGCGAGCAGGGGAAGTCCTTGTTGGCCTCACAGGCTGCAGACATAGAGG
CTTGTCGGAATCTGTAAAAGGAATCATTACTTGACGATTTTGCTCTCTCTGGGTCTTATG
CTTGTGCGATGAATGTTGTGTTGTAAGCTTGAAGGAGGAGGAGAAAAGGATTCTCAGAAC
TCAAAAATAGTTTTGCTCTTCGTTGAAGCTTTTTCTTATGACATTATTCTCACCACTCTT
CTTTGTGGGCATGAGTCCATGTCCTTTTTTGTATTCTTCTGTGACTTGTCTTTTTTTGAC
CTTTGCATTTTTGTTTTACGGTCTCAGTTATTATATTCAGTTGATTGTTGTTGAGACTTG
AGACCCCTATAAACTGGTCGGTTCAGATAATTACATTGGAAATGTTTGATCATCGTCTTC
CTATTATTCCTATCTGATTCTGAGCTAACATTAGTTGAGTAAATGATTCATTCGACCTTA
AGCTTTATCAAGTTTGATCAATGGGCCTGAGTGGGCTTTGTAAAGCGTCACAAAAACTCT
CCCGCGCAGGACAGAGAATCATTAGTTATTATCCTGAAAACTAAAATACTTTTTTTTTTT
TTTTTCAATTTTAAACAAAAATGAGTTCAAGCGTAGCTGAAGCAAATCACACAGAGAAGG
AAGAGTCGCTGAGACTGGCAATCGCTGTTTCTCTGCTACGATCTAAGTTTCAGAATCATC
AATCTTCTTCTTCTACTTCCCGTTGTTATGTTTCTTCTGAATCTGATGCACTTCGCTGGA
AGCAGAAGGTGAAACTTCTCGATTTTTTTTTATTTTTTTTTGCATTTGGTTTTAATGGCC
TTCTCGTTGCGAACTATCTGATATATATATCTGGTGAAATCTACGAATTCTAGGCTACAT
TTCGATTTCTGTTCTTCGTTTAGAAATCTAGGTCAGCTCTAATTGTTGCGAGACGGAGGT
TCTAACATAGTGAGATTTTCGATTTTGAAATTAGGCTAAAGAGAGGAAGAAAGAGATTAT
CAGACTCCAGGAAGATCTCAAGGATGCTGAAAGTATTTTTTTCTGCCTCTCTTAACTTTT
GCAAAAATTCGTTTCTGTATTTATTGATTCTTAAAATGGAAAGGCTGCAAGATGTTTCTA
GAACTGATTGGTCTTTCTATTAATGCATTTTGTGTCAATTATAGGTTCTTTTCATCGTGA
CTTATTCCCAGCGAATGCTTCTTGCAAGTGTTATTTCTTTGATAACTTGGGAGTATTCAG
CGGTAGGAGGATTGGAGAAGCCTCTGAATCGAGATTTAATGATGTTCTTCGTCGTAGATT
TCTCAGACTAGGTCTCTTTTCCTATTCTTAGGTTCATCAGTCTGGTAGCTTGAACATTTT
GTATTCTCTTTGTTACCTTTGTGTTTGTGGGCTTAACTTATCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1431, 2090..2161, 2267..2362, 2465..2674, 2776..2873, 2993..3080, 3173..3523, 3611..3853, 3938..5284
1258..1431, 2090..2161, 2267..2374, 2465..2674, 2776..2873, 2993..3080, 3173..3523, 3611..3853, 3938..4936
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved