Arabidopsis_thaliana Locus L7Ae/L30e/S12e/Gadd45 family
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana L7Ae/L30e/S12e/Gadd45 family
Arabidopsis_thaliana
L7Ae/L30e/S12e/Gadd45 family
5
SnoR100-2, AT5G01505, SnoR100
2016..2121, 2226..2367, 2475..2591
4375
attggtttttgaaagaagaaaaaagtgagggaaaacagagtcaagtccgattacttttc
tgggaaagctgaggattttgtgttcttagagagcagatgaagaggtgactgttgtttctg
gtgagaattcgacctctttagtttgtttgttttttcagttaatgaagtgcttgttattga
agtgtgtagttgactgataagcgccttagctttatcttaatgtttatcaagtagatttgg
cgttggataattaaaaagaagttcagattcttgtaggttgcttacttcgtctgaccaaac
aatgttcctgaaaaagtgttgtgttttgtttcatgtatcaaaaagtctagcttcaaaatt
ttcttgcttttttccaacatgcaagatttctctttataaatcggtacatttgtaggtaca
aatcggtacaaatttgccattgtataaatcggtacaaattttcctgtgttcttgtaacaa
tgccctttatacatttgtaggtgagatagaagttggcatctaaatttgctttctctggac
cagtgaaatcaattgcagtctcctatatattgtagtaggcgatgtatcagtggtgaagcg
aggatgacatctgtgggtacttgttcttaatccttcactctgatatctatgctttagaag
cgtttcaagttcatgaagctgatttgatgttgagtttttaacaacaagaatcaattcact
ccaaaaatatgtaaactctgccatgccttgagctgctttttggattatccactgttttgt
tttgtgattaagttcattattttctactatatatgatgaaaccgaaaattgttaattgct
aacgcaaacactgatctccatccccatgatattcctacgtacttattgacccgacaatga
cattcaagctccaaacatcaatcttcacttatggctttttgttagttgtttgtacatttc
ctcaagcaagttagaaacacgttttggtaatagaatcatactgttttttggtaatatata
tagataatggatgtcatggataaagcaaaatcacttggtgaagtttttaaaaaagtcttt
tcatctgagcatccgataaaaaacctcatactaatcgttggaatttatttgcgagaatgt
ggttaaataacattcaccagctacagtaactaacattatcttaaggaaaatttgattttt
ttttttttttttggtcggatttgatttttttgattttcaagctaaacaacatacaatatc
tcaaagtcaaaagtcaatgaatgtagcaaatcttagtctgtatgaaggcccaaataattg
ggccattatatgcaaccagtttacctcattaacaagcccatatgaaattagggttcctat
attttactggtcaataatacacttctctataaaaaccctaacacttctggtcatataaca
accgcctaaaccctagttttttccgccacactcttccgccattatttttgttacttggag
ctagctagctaaaaaatatgggaagcgataccgaagcagagaagtcgattcaaaaggaga
agaagaagtacgctattactcttgctcctatcgctaaacctctcgccggcaaaaaactcc
agaagagaactttcaaactcattcaaaaaggtaccaatctcagttccaagctcgcttcac
atctctctatcttctttatttctcattatatattgattagtagctcatgttggtgtattg
ctctgtaatttttgtcagctgctgggaagaaatgtttgaagagaggagttaaagaagtgg
ttaagagcataagacgaggccagaaagggttagttttttcattctttgtctttttattga
gtgtgatttatgattgttttgtgttgcagatggcttagctgatgtatatgtgttgatgtt
ttgtgttattaattgattagttgatgttattgtcctgcaaattgcttagttagttttgaa
atccgtgtacaaataagccgatgctctggattaaagtaatgaatgtagcatggtactgta
cacggaaactgaactatggatcgacatgtctgccatctctgattttttccctgattagac
ggcctggtttagatccacattctctgtttgtgttgtgattatgtttgtgaaaacggtaac
atgttcttctatgatcattcatgatgttatctactagtgtaagctctttatttagctgat
tttgaaagccgtctacaattaagccgatgctctggattaaaatagaatgaaggaagcatg
gtactgtgcacggaaactaaactatagatcgacatgtctgccatctctgatttttcgtga
tgagacggcctggtttagatctacattctctgctttttgttacttattatgtttgttttc
attgatgttatgatagttgtttgcatagttgatgttatatccgtgtacaattaagccgat
gctctggattaaacagaatgattgtagcatggtactgtgcacggaaactgaatcatgggt
ttcaaatgtctgtgcctgctctgagttccttattggttctttgatttgcgggcctgattt
gaacccacatttttacatttctaattgttttttccttcttctacgcaaacagtaaattct
tttatgttttgaatgttgtatctgatgtgatacgtttgtgtttgtgcagattatgtgtaa
tagctggaaacatttcacctattgatgttattactcatcttccaatcttgtgtgaggagg
ctggtgttccttatgtatacgttccttcaaaagaagtaagccaattttctttcttgattt
ctatcatcttaccaattaatcggttttgtggtgctaagatattcaatattttttttatga
aattcaggatcttgcgcaagcaggggcaacgaaacgaccaacatgttgtgtcttggtaat
gcttaaacctgcgaaaggagatttaactgcagaagaacttgcaaagttaaagacagacta
cgaacaagtctctgacgatattaaggagctagcaacttctgtaatctgattagaaactag
aatgggtgttcctcttgtgcttttgatggttaatgaatatcatcatatttacggcatcgg
atattactttggactatttaaggtttttgatattgtagcgctaatcgattgtaaaagttt
gaatcatgaatcctatggtttcatctggttagtgctctctttatggcgtttttttaaatc
tcctccttacgtgtttagtcattgtctccttacgtggtcagtacttagtcatgtcttcgt
gctatcgattggttattacatcattatttattatacagactaatttagtttttgttaata
atcaacattaagttatacacaacttttatttggcatagctatatatctttttgaattgtt
atgttagaagtttgttgaaatgaaagattacggttgaaatgacaataaaaacaagaaaag
aaaaagaaaaatatcaaaacaacttttgtcgtgtttgggtcactagattgggtttaggat
tccgattctgctcgcctctggattctgattccgctcaccactaatagtggggtcgtgccc
ggtcgtgtaatgagcataagtttcagtcgaatagttaaaaagatggggtccaactgtaag
aaaatatattctatacgggtctcttaagaaaactgagaaattgtttcggaatctttttgt
gtacctttctttttttttctcttcttggtcagaaaaagaagtattaggaatcaataacgc
atacggtatacacatcagtttaaagcttacatctgacttctctctcacaaaaacatcgtg
aagaatggaggagtcacgagaatcgccggcggaacacggctactacatgccggcggaatg
ggattctcatgctcaaacttggatcggttggcctgtaattctctatctctcttcctcttt
tctttttttttcatgttttattcattaacctgagataaagtaaaaattgacggcgattct
ggagaactcaatctcgctgttcaaaaatcaaacttcgatttcgattttgtcctttttttt
tttttatatggatcctgctcgtagtttatcattgttcgaattgctgttttctgtttattt
gatgatttctctgcttcctggttcgtttttgtagagtttccgataaattttgtatagctt
ctgtatgtcaagttagcatctagatgtgacatgagatgagatcttttacattgcaatcta
tcatggttacagattctgcaaccaaatcagaatttaaagcattttcagttaggttgtttg
tttcgatttgtttcatcactgaatacatgaatcaaacctcaaaccacttttgtgat
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1649, 1758..1827, 2689..2794, 2887..3307
1517..1649, 1758..1827, 2689..2794, 2887..3048
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved