Arabidopsis_thaliana Locus FASS
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana FASS
Arabidopsis_thaliana
FASS
5
SnoR104
3781..3898
5406
ACGTCCCGCCCTGAAATGCACACTCTTGCGAAATGGCAACAACGAATTCATAGACCCAT
CAACCTCTACATACACATTCCCTCCTCTCCCTCCATCTCCACCTGAAGGTCCTCCAAAAG
GAACAAACTTTTCTCTCCTAAACGCCACCACACCATTCCCTCCATCTCCGGCTCTAACAT
ATATCTTCGCTCTATCGAAACACCTCATCACAGCCGGAACTCCTTTCTCCTTCACCCCAA
TTTCATCCTCTTCCTCTTCACCGGAGAAACATAACACTTCTCCATCCTTCAATTCAGACC
CTTCACTATCATCTTTCTCCGCATCAGTTTCATCACCATACTCAAACACTTCGTCTTCCC
AATCTTCATCATCTTCATCAATTGATCTTGAACTCCCTTCAAACACATCTAATCTTCTGT
AATTTCCCCAAATATCATCATCATCATAACTCTTCACCTCCTTTTCTTTCTCTTCTTCCT
CAATTTCCCTCAAAGTTTCAATCTTTTCCTCAACCCTCGCGACATTGGACTCAGATAGCT
TCACTTCTTCAGAAACTTTTAAATAAGATGAAGACAAAAGAGAGACATCATAGTAATCTT
CCCTAGGAGGAAGACGTGTATAAGTAGTGGCTTCGCCGCCGGCATCAGAAACTGGCTGGA
GTTTATCACCGCCTCGAGATTTAAGCTCGACTTCGCGTTGAAGCTTCGTTTTTCTAGGGC
TTCGGGTTCTTCCCGAGACTTTGTCAGGTTTAGCGAAAATCTTCCTCGTCCTACTGGGTC
GGGCTAGAGCTTGAGGAGTGAAGAAACAGTTAATGGATATGGAAGCCATTTGTTTCTCTG
ATAAATCTTAACGGGACTTTATGTGATATAAACAACATTTTGTACTAAATATTGATTTTT
CAAAGTAAAGGGGGTTACAATCAAAAGTAGTATAAAATTGAGGACTTATATAGCAAACAA
GGAGAAACTTTTATTACCTTTGAAGTTTGAAGCTTGGATCTCGCAGATTGAGCTCCAGAG
AGGGAGAGAGAGAGAAAGGGGGCGCTTTAGGGTTTCTGCAGTTCCTGGTTCAGTCTCACC
ATTCTATTTAAGGGTTTTAATCTCTCTGCTTCATTTGGTGACTAACATTTATCGTCGAGG
GTTGTGACGATCTCCGAGAATGTATAGCGGATCTAGCGATGGTGAGAGTCATGATACATC
GACGCAGAGGAAGATCCCACCGGCGTCTTCGATGCTTTGGGTTAGAAATCTACGACGATA
TATTGGTTCCGGTGCCGGATTAGGATCCGAAGCTCTAATGGGTAATGTTCCTTTTGCCGG
TTGTTGCGTTTTGGTTGTTGGGACAGTCTGTAGTTTTTTTATCTTTTAGCTTGTGATGAT
GTCATAAATTCTGTAAAGTTTGAATCTTTGATCACATTTTAGAGCTCGTTGTGTTTTCAA
TATGAGTAAAGTTCCTGAATTTACATGTCTATGTATTGAAAGACTATGTTTAACTGTGAT
AGAGTCTTTGGTTTTGCTTAGTTTGATAAGGGTTTGTGTTCATTGTTTTGTAGAGCTTGA
GACGAAGAGAATCTTGCTCGAGATTTTTAAAGAGAAGCAACAGAAAAGCCAAGAAGCAGG
CACAATACCGAGTTTCTACAAGAAGGCATGTCCCTTACTCTGTATAAAATGATTGCCTTT
GCATTTCAAGGCACTACTCGGTTAAAATATTGCATTGTGTTATACACTTCATAGAAGTTG
TTTTTCCTTTTAAGTATTCGTGTTAGGCAATAAAATTTTGTTCCTTTACTCTTGGTTCAG
AAACCAGAAGAAGGATCTATTAGTCAAAGGGTCCAGAAGCTTGCAAAGTACCGTTTCTTG
AAGGTATTTCGCCTGCTCTTAATTATTCAGAAGAAGTTTAATGTTTTTGCTCACTTCGAT
ATGTTGATTAATTCCCACAGAAACAATCGGATCTTTTGTTAAACGCTGATGATTTGGCTG
CTATGTGGGTTTGTTTGAGAGAAAATTGTGTGATTGATGATGCCACTGGTGCTGAAAAGG
TACGTGCATCTTTTATAGGATTTTTCTCTGGAGCTGAAACTATGTTAACAATGATGCTGA
TATTGCGCTGTCTTTTTCATGTAGATGAACTATGAAGACTTCTGTCACATTGCCTCTGTA
TGCACTGAACAAATCGGTCCCAAATGTCGCCGGTTTTTTAGCCCATCCAATTTCATGAAA
TTTGAGAAGGATGAGGCTGGGAGGATTGCCATTTTACCGTTTTATCTTTATGTGATGCGC
ACGGTGAGTATCCTTATGTTTTTATAATGTCATGTCTTTGGGTATCATTTTTGTTCATTG
GCTGAATATCATCTGTCGCCATAAGCTAAATATTCTTTGGTACTGTGTTTGAGTGACACC
AGCTTTGCTAGTTTTGGATGTTTGTTTTTCAAGTTTTTTTAATTTGGCGTGTCTTTTACT
TAAACAACTATAGTTAATACTTGTTTTGATTAATCATATGTTCAACACTATTCAGGTGTC
GCTTACACAAGCTAGGATTGATATGAGTGAGCTTGACGAAGACTCTGATGGTTTCCTTCA
TTCTGATGTAAGTACTCAAGTGGCTCTAAAGCTTTAACTTTAGAATTGGCTCAAGATTCT
TTAGGTAGTCGTCCTACCTGCAAATGTCAAATGGTGTTGACTTTTATGTCAAGTTCCTTA
CAGTTAGTCTACTTGCTGTTGTTATTATAGGAAATGGAGTCCTATATTGGTGGTCTAATC
CCTAATCTGGCACAACTGAGAGACATGCCTCCGGCCTTTAATCAAATGTATTGCCGCATA
GCTTCACAAAAGTTTTTCTTCTTCTGTGATCCCCATAGGCGAGGTAAGTGAAAGAAAATA
TTATTATTATTAGGCAATTAGAAATTTCTTTGACCCAGTATTCAATCGCTCGTAAATGTG
ATATTTTTTGCGTACAGGAAGAGCCTGCATTAAAAAGATACTGCTCAGTAACTGTCTGCA
GGAACTAATGGAATTGCATCAGGTAAGTTTAGTTGAAGGATGTATGACATACAGCTTCGT
CACCGTATAACTTTCCACTTTCATAAGCTACTTGCTTGTGTTTTCTGATTGTTCCTTGGT
TACTCAACGTTAGGAAAGCGAGGAGGAAGTCACAGACACTGAACAGGCAGAAAATTGGTT
CTCTTTGACTTCAGCCCAACGCATATGTGGTGGGTGTGCTATTTTGTCTTAATAGCTGCA
GAGAACTGGAAACAACTCTCGTTATGTCATATTAAGAACTAAAATGGAGATTGATCTAGA
GTTTCTCTTTCTTCTGTAGATATGTTCCTCGCACTTGATAAAGATATGAGTGGATCGCTG
TGCAAACAAGAACTTAAAGAATATGCTGATGGGACCCTAACTGAGATTTTCATTGAAAGA
GGTAAATTTAAGCCCTTTTGGTGATTGTAGGCTCGTGGTACTGATCGAGACACGCTTAGT
ATACTAATTCCCCTTTGTTTTTTTAGTGTTCGATGAGCATGTCCGCCGTGGTAAAATCGT
GGCAGGCAATTCCCGGGAAATGGACTTTGACAGTTTCCTCGATTTTGTTCTTGCTTTGGA
GAACAAAGATACTCCAGAGGGTTTGACGTATTTATTCCGTTGCCTTGATCTCCAAGGGAG
AGGCTTTCTCACTACTGCTGATATTCACTCTCTTTTCAGGTAATGAATCTCTATGAAGCG
ACTGAATCTGTTTGGTTTCTTACTTTTTAGTAAATTTTGTTTGAAACATGGAAGTAAAGA
AGGGGAGCATCAAAGAGTTGTGATGTTATCTGATACAATCTTCCTAAATAAACACTCTGC
ATTTCCTGCTTGCGGAAGCTGAGCTTTGTTCCGCGAGTCTCATATCTGCAAAGACACTAG
TGCATATCAAACACACCATTGATGTGTGATAATGCCATTGTCTCTCTTCTGAATTCATCT
GTTTAACTTGCAGAGATGTTCACCAGAAATGGATAGAAGGTGGGAACTATGAACTGTGCA
TAGAAGATGTTCGAGACGAGATCTGGGACATGGTGAAACCGTCTGACCCATTAAAGATCA
CTCTGGGTGATCTCTTGGGATGTAAACAAGGTGGAACCGTTGCGAGCATGCTTATAGATG
TGCGTGGCTTCTGGGCTCATGACAACCGTGAGAACCTTCTTCAAGAAGAAGAAGAACCAC
CTGAGGAAGAGTCTCAGTGATAATGTTATTTTCTATGTCTACCTAAAAAAAATGCTAAAT
CATTGAGATCAAAAGTCTCGCACTAGTAAACAGTCTCATCTCATGTGTGTGTATCTTTGT
AAGCTTATTAGTTGGTGACGTTTAATGAAATGGCTGTTTATATCGTCACTTGTCTTATTC
TACTTGGGATCTGATTTGATTTTTGACATTTCTGAATTCACTTCTATTATACATTACTCC
ACAACACACATGAATTCAGTCATGTCTCGAGTACTACAAAATGGAAGTCATAAAAGTTAT
CGTGTTGTCTCTGGTCTGTGTTTAGACATGGAAAGGCTTTCTGGGTGTAGCAGCTCTGTT
CTCTAGAGATTGTAATCTTTGCTTCAGATGAAACACTTCAACCTGCGTTCATCTCAAGTT
TTTAGAACAATACTACATTTTGAAAATGCAAATTTGAATAGAGTCTATTGATGATTATGA
TGACACCTGCAACTGGAACGCTCTTGCTCTTTCTCCTGCAAGAACTCCTCTTGTTGAATG
CAACTCCTACAAAACCCATAACACAAAACGGTATTAAACTTTAATCCTCAGTCTTTTGAA
AACGCTTGTATATCTACTAGGATTATTTTACCTTTTGTGTATCGTCTAGGACAGCTTTGA
GGAACGCTACATCATGCTCAAGCCTGACATTGTCGGAGTGAACCATGTTTGACAAACTAT
TAGCTTCCTCTTGAGCGAGCTCTAACCCGGTCAGCTTCTCCTTAAGCAATTCAACATCTC
TCATGGCGTCAGATAACTTTTTATCAGTCTCTTGTTTGCTCCTCAACGCAACCGACACAT
TCCTCTCAGCCGCCTCTCTTCCCGCCAATGCTGCTTCTAACTGCCCTTCCAGAATCCCAT
TTCTTCTTATAAGAGCCGTCATTTTCGCTTCATGGAATTGGTACACGCTCGATGAGGACG
CTGATCCTGCAAAGTTGATATTATCCATTTCTTGGAATATCAAGGCGCCATCAACGTTTT
CTAAAGGATATGTTTCAGAGCATTGCTTCTGGAGACTTAAGATTTCACGGTCAGAAACCA
TAGAAAGTGTTTTCTCTGCTGTAATCTTTGCTCCTCCAGTATTGTCATCTGTGGTCTGAA
ACCAAGACAAGACGTTTTAAAAGCAAATTCAAGAACGTCAATAAATGCAGGTGAATCATG
AACTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1300, 1553..1644, 1800..1862, 1940..2038, 2124..2282, 2515..2586, 2730..2862, 2957..3021, 3133..3208, 3319..3420, 3506..3698, 3973..4406
1159..1300, 1553..1644, 1800..1862, 1940..2038, 2124..2282, 2515..2586, 2730..2862, 2957..3021, 3133..3208, 3319..3420, 3506..3698, 3973..4219
CP002688.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved