Arabidopsis_thaliana Locus Mono:SnoR106
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR106
Arabidopsis_thaliana
Mono:SnoR106
5
SnoR106
1001..1253
2612
TGGTAGGTTCATGGCACATCTTATACATTTGAATTAGAGTAATACAGAGGAAAAGTACA
TGGAGACTGAAGAAAATTGCTATAATCGAGATTTCTCCAAATTTGCTAATTGCGTATAGA
GCTACAAAAGCGAATTAGATAATAAGAGAGAAGGGTTTGTTAAGAAGGTAAGGAGAATGA
AGAAAGGAATCTCCTTTGGACATGAACACAAGGAGAAGAATCTCAGATTGTCGAAACCCT
GGTAATAAACATGAAGAAGCTTTTGTGTCACTCACTTTTATGAACAATAAAAAAGTTGTT
TTTAGCCAAATTGAAACATAACCAGTGAAACGGAGACCTTACCTCAGCATATTCGATGAA
ACACTGAAATTGAGACGCTCTTACTGATTAACAAGTTAAGAAAGAAATCGTTTTTTTTTT
TTGTGTGTGTTTATCATCGAAACAGAGGGGAAACAGGAGGGAGCGAAGAGAAAGGTTATT
TTATTTGGGCTAATGGGCCAATAAAAATAGAACCTAAAGGCCCATAGATGTAAACCCTAA
GCTATAAATAAAAGACTTCGTCTTTGATTTCGCCGCAAGATATTATCTTCACGAAAAGAT
CCGATTTTTTTGTTCTGATTTTCTGTTAAAATCTGAATTTTTCGCTACGAAATCTTAGGT
TAAGAATAGCATATAAGGAACAGATTTGTGATAGGAGTCTTTAAGCTTAGCACTCATGTA
TAGCTTAAAAGAAATCTTATGTTCCGATGCTAAATCAAACATCTTCATTGATGGTTTGGA
GTCTCTGGACATGTAGCATTCTGGGAATTTTTTTTCCCGTGGATTCTAGCATTTTCTCGA
GATTCGACATCTTCCTATGTTTTTAATTCTGATCTTATGTTTGGATATTTTAGATCTTCG
AATTTCTATGATAAAGTGTTAACCTTTTCTCAAATAAAGGTTTTGTGAAAATTTGCTTTT
TGATGCTGCTCTATGATGATTCTTTTTGCTTTAACCACACTGAAAAGATGGGGTTGAGAA
TGTGATTTTGCTCTTCTTGATTCAAACCAGAGAAAGATTAGATTTGATCTCGGAGTTTCT
TGATGACACTTTGATCTAAGTTGCTTGAAGGGGATTCTTTTTCTCCTTTGTGGTTTAGAT
TAAGGTAGAGAGTAATGTCGAGCTCTTATCAACATTTTTCATGGTTTGAGGCTTGAAGAA
CATTCACGTTTTTCAAGCTCACTCATGTGGACAACCTTGGCCCTTGTCTGAGAAGCAGCT
TTTTCTCATATTCAGTTTTTCTAAATTTGTTGTTTTAAAAAAAAAAATTGGTTTGTTTTT
TTGGCTGTTCTATGATGATTATATTGCTTTAACCACACTGAAAAGATGGGCTTGAGAATG
TGATGTGGTTCTTCTTGATTTAATCCAAAGAAAGAGTTCTTGAGCTATATGTATTGCTTG
ATGACACTTTGATCTAAAATACTTGAAGGGGATTTGTTTCCCTTTGTGTTTTAGATCAAG
GAAGAGATCAGTGTAGAGCTCTTGTTCGATATTTTTCTTAGTTTAAATCTTGAAGAACAT
TATCATTTTCTCAAGCACTCATATGTGGAATCATTGTGCCCTTTGTCTGAGAAGCAGCTA
TGAATTCTGTTTTTGTCTTCGATATTGTTAAACGTAGCTGATTTGTAAGATTACTTTGTG
ATCTTTTTTGGATGCTTGATATGTATCCAACCAAGAGTGGGTTTCTTCTTACAAAGATAT
TGAGTTAGGAATTTTAATGTCATTTTATGTTCGAATTGGGGAAAATTCACAAAAAATTGG
GAAAATAGAAGAGAGCATTATTCGATGTTTACCACATGGTGGAATAATTTGACAGAACAA
TGTACTTTGGGAATGACATATGGAACAAACTGTGTAAACCAATTTGATGATGAAGGTGAA
CGAGTTACATATAGGAGACTTACACTTCCATAATAATATTCAGAAACTATATGAAAGTGT
ATCTTTCTTTATTACTAAAACTCTTTTCTAATAAGAAATGTGTAAACTATGTAACTCGGC
AACGGTTCCAGACTCTCTAATCCTAAATCAATGTTAAAGGCGTAAGGCTCTTGAACCTGT
TCATTGTGAGCTTTGAACTAAGTATTCAATTTTTTGGACAATCCGAAAAACACAACAGTA
TAACTACAAATGGATTAGTCCCATTTGGGCGTAGTCTCATTCGTTTGGACGAGAAACACA
ACGAAAAACCTAGCCAATTTTGTTGTTCTCATGTATGGGCTTAATTGGGGACTAATCCAT
CTGTGGTTCCCCTTGTTTCCATAGTTCGTAATTTTATTCGTTTTTCGTCTTAAGTTTTCC
CTTCTTTAGGTTTAGTTTCCGGAGATATTTTTGTTTTCCGCCGGCTTTGTGTTTCAAATT
TGTATTCCACCCTTTGTATTTCACAACCTATAATACAATGGAAAAATTCTGGATGAAAAA
AAGAAAAAGAACACAGTATATAGAAAAATCTGAATCACAGTACTAACATCATTGATTTTC
TGCTACAAAAATGAGTGTACACTGATTCTTAAAATAGATACGGGCTATAACATAACAAAA
AGAAAAAGTGGGGGATGGCTTTTGCAATAATCT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.8
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved