Arabidopsis_thaliana Locus Poly:SnoR12-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR12-2
Arabidopsis_thaliana
Poly:SnoR12-2
5
SnoR12-2, U24-2
1001..1089, 1155..1237
2237
CAGAAAACAAACCTTGAGGAGAAATGCCGAGAAACGGATCGTTCGGTGGAGACGAGCTT
GATCTAATGGCAGAAGCAAGGAGAAGAAGAAAGGATAGTTGCAAAGAGACGGAGACAAAG
GAAGATATTACTACTACTCTCATCTTCTTCGAGATCGGAACCGGAGAATGAACGGAGAAT
CAAAAGATTTGGCCACGAGAAAGATCAAGTGCAGTGTCTGTGAGACAAAGTTTGGCAGAT
TTGATAAAACGACACAGTTTGGTTATGCATCCTATTTTGTATAATTAAAATTAGGTAGCT
TGATTCAACTTAGTAATAAAATAGGCCCATTAGCTCAGTTGGTTAGAGCGTCGTGCTAAT
AACGCGAAGGTCGCAGGTTCGAAACCTGCATGGGCCATCAATTTTTTAACTCTGTCCTTT
GTCGAAACGTCGTCGCTTTCTTTCTTTATTAGCCGTCACTCAAACTATAAATTTGGTTAA
ACTAATGGGCCTATAACTAGCCCAAACCGAATAAAATGGCCTTTCGTCACGCTTTAAGAA
CTAGGGTTTTCGAAAGTCCACCACTATCATAATTGCATATATAAACTCATCTTCTCTGCT
CAGTTACTTTGTCCGATCAAATTTTATTCTCTCCGCCGCTTATTTGATGTGCTATGGTTT
AGATATCTTATGTTGATTCGATTTTTTTCAAAGAAAGCCTAATTTGCAAATTTCTTAATC
TATACAATTTATTTGTAATGGATTGAGGAATCTATCGTTAGGCGAAAGAGATGATGGATT
TGTAATAATCTCCGGTAAGCTTACGTGAACCTCCGTAAGCTTGCTCTGCTTCTGAAAACT
CCGAGTTTTCTTTTTCTTGACCGAAGGATACTCGGTGAATAGAGGCAGATACATCTATCA
ATCTCTGAATCGAAATTGCTTTGTTGATTTTTTTTCCATTAGATATATGTAGTGTATGAA
ATTGTGAAATTCTGTGTTATTGATAGTGGTTGATGGAATGGTGAGGGTGATGAAAAAAAT
CATTCGGATTCCCAATGATTCCCTTACGTACGGGAAATTATGTGATTATTTACCAGCTAC
TTTTGACTCATCATCCATCATTATGTTTTTTGGTTCTTAAGTTTTGTTTGCTATGTATTT
ACTAAGTTGTTTTGGCCGGTGATGTAATCAAAATATTTGCTACTCTTGATGAAGAATTTC
TTCAGTTGATGATATTTACCACCAAGATCTCTGAGGCCTTTTTGAATTGTTTTTAAAACT
AAATGTCCCATACAATCCTTGTTTTTGTTTGAACTAAATGGTTTTCTTTGTACATTTTTC
ATTTCCGTAAGCTAAGTTCTTTATTGACATTTTTAGACGAGTCTTTTACTATTCTTTTGC
ATTGATTGCTTATAACCAGATAAGAACTAAGATGTAAAAATAAAATACTAAAGAGAAGAA
CTTTAATAATGTGAGTAAAATTATTTATCGTTTGCTTGAGGTTATCAAAATCTGTTGATA
ACTATTGAAATTATTTTCGTCGGGCTAACTACTTATCACCTCTTTCTATAAACTGATTAT
TAACAATTCGGACATTCCAAAGACATTTTTGTCGAACTAGAGTAAGATGGTGAGATTGAT
TAATGGATATGTTTCTTGCCCAAAAAAGGAAAAAATGGTCTGTGTCAGGATAAATTTACC
CGATCACTCCCACACACGTTACATAGAACAACCACATCGATAAATATGCTGGTGGTGTAT
CGTATGGCACGTGTGTTGGTACAAACAAATGGTGGATCGTTGACACGTGAACAAAACTTA
ATTCCAATGGTTATATCGTTATGAACTCCCAAATGTTTAAAAGCATGCACCACCAATAAT
CTTATTCTTTTTTAGCCGATTGTTGGATACGACATGCATAAGCCCTTGAATTGATATCAA
CGTGAAGCCGAAAGTGAGATTTAGGTCTGACATGCGCAATACCACTGAATTGAATTGGTA
CCCTTATTTTTTGTATTCCACTAGGCACTAGTAGTAGCTATGATATATAATCGATCAATG
AACTAATAGTAATTTCAAGCCATGCACGCCGATAAAACAGTACAAACCTCAAAATGATAT
GATATTGTTTGGAGTTGTTAACTCTTTAATTATCGTTCTTTTCTTCATATAAAAAATAGG
ATTTTTAGTAATTAAACCCCCCAACTAAAGATATATTGTGAAAAAACCCCTCAATTATTT
ATTTAATGAAAAAACACC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.8
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved