Arabidopsis_thaliana Locus Mono:SnoR29-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR29-2
Arabidopsis_thaliana
Mono:SnoR29-2
SnoR29-2
1001..1100
2100
ATCGGCGGAGGATTCAGAGTCGAGTGAGGAAGATTCAGGATCCAACGCCGTGAATCGCC
ATCTGAGTCTCCGATTTCGCCCTAGTGAAGAAGACAGCTTATACTGTGAAAACCGCCAAG
TGTACGGATCCGGTGGGTAGGAAACAGACAAAATCCTACCCAAAGATGACATCTTTTCGA
TATCTTCAGCACAAGATCGATCATACAGATTAGTTTTGCCTGCTCTTAAATGGTCGGTAT
TGTATAGTGAGAATTGAGAAATCGAGACCGAAAGAGAGCAACTCTGCTCAACTGTATGTA
CGTGGCGAGTTCGTATTGGTGCTTATTATTTTTTAATTTCACACTTGTCTTGTTGTTTAG
GTTTGTTTTGAGAAAACTTGTGGTGGCAGAATTCTTTTGTTGCTGACTTGGAATTTTTTT
AAATGGATAATTGATGAATAATTGATTTTTTTGTTGTTGTTGTTGTTGTTGTGAGTGCTA
ATAAGATATACTTTCCACTAATTTAAAATTATGTGTTCTTTGAAAATAAAATTGTAACAT
TCATATTTGTGTGTTATATACAATAGTCAAACTTAGCAAGGCTTTGAGTTTAGTTTAGGG
GATAATACGACCTACTAATCTCCCAATTAAGATTAATAATCCAATTCTGGATCCTATTAC
CAAATTAGCCTTAAAAATGTGACAGTTTTGATGAATTTTTTACGTCTAAAAAACGAATAC
ATAGGCCATGAGTTTTGAAATACAAATGGGCCGAATCAAATTAAACTAAATGTTTGGTGG
GTTTTATAAACATTTTTCTAACTAGTAAGGCCTACTTAAATATTTCGGCCCAATTAAGCC
CTAATCAAACAAGGGTTATGGAGAAACCCTAGGCAATTAACCTATAAATATTAATTTCAA
TTAATCTTCATCATCAATCCAATTCCTGGGTTAATTAGCAATCGCCTTTTCCTAGTTCTT
CTTCTTCTATTATGATTTTTTGTTAATTCGGAAAGAGAAATCGTGGTGATGACTTGGAAA
TATTCAAGCTCAACAGACCGTAATGTAGGATTTTTCCTAGTGGAAAGTCTTGCGTGTGTC
GATAATCCCGCTGAACTGAGCGATTTCTCCTCTTCCAAACTTCAAATATTTTCGAATATT
TTTTTCCGATTTTCTTCTCATAATCTTTTGGATTCTAAAATTTGGAGATTACAATGAGGA
GGATCCGCAACTCCCTCTTCCGATCTTTGATTTGACGTTAATTGGCTTGAGTGATCTCTT
CCTGTTACCAAACAAAGAAACCTTTTGTTTGAACAAAGTATCTGTTCCCTCCATTCCAAA
TTAGGATCTAGCCGATGGAGCGTTTTTTTTTTTTGATGGAGCGTGTTCTTGAACAAATTT
TGTTAAATATCTCTGTCACGCATTAATTCCTAAGAATACAATAGTCATAAGAGATATAAT
TATATGACGTATCTGTAGTTTGTTACCAATATAATGTTAGAAACGCGTAGAGATACATAG
TCAAAGCACATATGCATGTGATGATGCTTTTATATAAAAATCAAATGATGCATTTTTGTG
CTAAGTGTGTAATAATAGAGGAAGTGGGTGGAAATAGTAGTCACTAGTGAGGGTCCAGCA
CGTGGCACTACTTAAGCGTCACAGAATGTTGTTACTAGTAGAACCCTTGGGCTCTCGACC
AAATCGAAATTTTAAATTATACTCCGATATGAAGAGGAATGTGCCTACCTGTTTAAGTCC
ACTATCACAATTGATCCATATATACGTAAATCCATTATCTAGATATTTTTGAAACTAAAC
AGAGGAATGTTGTCTAAGAAACACGAATACTAACAAATAGGGACACTAATAATTGTACTT
TAAAAAATAATAATAATAATAATTGTAATTTGAAGAAAAAATTAAAAAAAAACTTCGACG
ATAGTGGATTGGGAGCTTTCAGATAAAATTTTGGGGGTAGTCTTTTAGATGTATGTAATA
AACGAATATAGGTTATGTAATATGGATATTCGATCATATCGTAAAAGAGACATTAGACAT
AACATATGGTAGTTGCTCCACCGTAGGCAGTTGTGCGTGTGGACCGCTTCACCGTTGAAA
A
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved