Arabidopsis_thaliana Locus Mono:SnoR108
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR108
Arabidopsis_thaliana
Mono:SnoR108
5
SnoR108
1001..1110
2110
GCTTACAAATTTTGTTACTTTTATTATGGAATAATCAGGATGTGGGAGAGTGACAGATG
AAGCAATTAGGATTGGTTTAGAGAACACTCGTTTACTTGGGAGAAGTCAGTTTCTGACAC
CAAAAGAAGCAGAGACTTTACTATTACCCGGAGCAACAGTGCTTCTTGATGGAGGTTGGT
TATAGCTTTAATGTTTTCTACTTCGGATCTTAGTCAATTGAAAGTTTTGTTTCTTCTCTA
TGAGTATCGTAATGTTAGAACCGATCCTCTTTCCTTGAAACTTTTGGTTTACGGTATCAA
TCTCTGGTCTGTTTTTCAGCTCACACCAAAGAGTCAGCGCGAGCCCTCAAGGAGATGATA
AAGAAGGATTTTCCAGAGAAAAGATTGGTATTTGTGGTTGCCATGGCTAGTGACAAAGAT
CATGTGTCCTTTGCAAAAGAACTTCTCTCAGGTCTAAAACCAGAAGCAGTGATTCTAACA
GAAGCTGACATCGGTGGAGGTAAGATTAGATCAACGGAGTCTTCGGTGTTGAAAGAATCA
TGGATAAAAGCTGCTGATGAATTGGGGTCAAGGTCTATGGAAGCTTCAGAAAACAAAACT
GTGTTGGGTTCCTTAAAGCTTGCCTACAAGATACTCAGCGATGACACAACAAGTAGTGAC
TCAGGAATGGTTATAGTCACGGGTTCGCTTCACATTGTATCTTCAGTCTTAGCTTCTCTT
CAACATTAATTTCCTTATCTTTACGAGTCTCTTGTAAAAAAACTCAGTTTGTGTTAAACC
AAACAAATCTTTTTCCTGGAACATCATGAACCGTAACATTTGATGGTAGTTGAAACCTTC
TGAAAGAGGCAGAGACTTTCAAAGAAGCAAATAAACAAAGTAGGTGAGATTATTAGTTGT
AGTTTTTGTCCCACATCGCTTACGTAGAATAGTAAGAGGCTTGTGAGCTTACTATATAAA
GAGAAGAGGTGGTTCAGTTGGAAAGTATGATCCTTCAGGCAAGTTATAGGGGAAATGAGG
AATGGTTATAATCTCGCTTTAATGCGTGATGAGCGCTCCGCTCAAAGCCTGTTACGACTA
ATTGGGCGCTCCAATTTTTATACAATCTGATCCCTCTCTTGTCCAAACACTTTTTTAAAA
TAACATTTTCACTCTAAAAAAGTACAAAAAATATTTTAATATATAAATTTTCTTTACAGT
TTATAATTATTAAATATTATATTCATAAAATTATCCCAATGGGCTTGGGTTGGGCCTTAT
AAGTTATATTCCAGTTATAATAGTCCAAAAAAAGGATAAATTATCTATTTTGTAAAACAA
TTTAGTTATGAAATGATAACCATTGAGGAAATTACAACGGATATGCACAGAAAAAAGAAA
ATTAAGTTGGGTAAGAGAGAGAGTGATGTTTTGATATTTTTACCCTTATGAGAGAAAAAG
AGATAGAAAACGAAAGAGAAGGAAAAAAAATAAAAGAAGTTCAACGTTCATGATAACTCA
TAAGTTAACAGTGATAAACAAATTATTATGATAACTAAATAAACTAATGCATAAATTAAC
ATGTTACAAGAATAGGTAATTGCTAATCTATTAGTTACTGAATGTGAACATGATAAAAAA
TAAAAAAATCGTTATATGTAATAGTTATCTATAATGTTGCATACAATTTACCAATTTAAA
AGACATGTTAAGGTGATAACTAAATTGCTAATGTATAGTTAAAAGTAATAACTAAATTAC
CAAAATAAATAAATATGTTATTACATATTATATAATAAATGATTTAACACAAAAAACATG
TTTTCGACGTAAGATAAATAGTGCTTTCATTTTGCTACTGTTTTTTAAAGACATGTTTAT
CATACTAATCAAATAATTAACTACCTAAATTTGTTACCGCCAAAACTTATTTTTTGTTGT
TCCATATAATGAGTTTATCTTAATATTTTTCTTGTTAACGTGTATATGTGACGAAAGATA
TTTTTGTCATTAATTTGAGTCAGATGAAAAATAACTAAATAGCAAATTTTCATGCATAGA
TACCTAATTATTTATTCATTTGAGCATAGATTTTTAATTCACCCTAACCATTTTTTTAAA
CAAATTTTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.8
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved