Arabidopsis_thaliana Locus Poly:SnoR28-1a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR28-1a
Arabidopsis_thaliana
Poly:SnoR28-1a
SnoR28-1a, SnoR28-1b, SnoR28-1c
1001..1094, 1174..1269, 1394..1490
2490
AGATCGACGATTTTTTCTCGTTTGAGAACCAAGCACAAGACAACGACAACTCAAACGTA
ACCCCAAACTCGGCAGGATTCGAAATGATTGGAGAAGAGATTATAGTAAACCATAAAATG
CTCATTAGTACACGGCAGACTACGGAGATTTTATACTATCAAGTGGTACCGTCGCAGATA
TTGAAAATTCACATAAATCCGGTTCATGGAAATGAAGAGAGAACAATGTTAATGGAAGAA
GACAGTGATGATTCTTGGTTCCAGAAGGCTGAAAATGTTGCGAAGATGAAACTGAAACAG
ATTAGTTTAGTTGCAAAACGTTATTACAAATGTCTTACTATTATTTTCTGATTTATGTAT
TTCATTATTTATTGTCGTATACTAACCCCCTTTTGGAATGAAGAGAGGAAAAATACATAT
ACTCAATTACTTGTATACTATATAGTTTGATTTCACTGTCATTGTTAAATAAGTAATCTT
TGCTAGTTACCAAAGCCCACCAAAACATAAGGATCCAATAAGAAATTCCTAATACCACAA
GTCACGTGAATAACACGCGCATTAGGGTTTCTAGACCGACATAAGCCTCACCACCGTACC
TATAAATACTCTTTTGACTAAACCTCAAAACACCAAAATAACAAGCCGTCGACTTCTCTC
CGCTAGATTTCTTATCCTTAATATGTTCTTCATAAGGTTTCCTAGGTTATGTTCTCATTA
GAAATTGTGCGTCAATATTACTGATTACCACCGTACTTGTTTATGTTCGTTGTGTATGAG
CTGACGCCAAATCGTTTCCCTATATCTGTTATTCGTTTTGATTTTCTTCGGAAAACCCTC
TGGGGTTTTCTTCAATCAGCTCGAATTTGCAGATTAGGGTAAATCTGATTTTGTATTAGT
GTTTTATAGAATTGTTTTAGGTTTTAGTTCATACACAACATTGAACTCGTTTTTTTTGTT
CTTAGAAATCGAGATTTGGATTGGTTAATAATGGAGAATGGAGGTGATGACAATTTCCCC
AGATGATCGAATCTGATTATACTGAGCGAATAGAACTTCCTCTTCGGAGGAAGTCAAGCC
AATTAGTCTGATCCTTCTCCTTAGATTATTACGATTGATTTGGGTTTGTTTGTTGATTTT
AAAACTTTCGTGGTTTTTTTGAAAAGAGATATGGAGGTGATGACAATTTCCCCAAATGAT
CGAATCAGATTATACTAAGCGAATTTTATTTCCTTCTCAACAGAGGAAATCAAGCCAATA
TTCTGATCCTTGTCTCTTTTATGTTTTTTTGATGAGTTTGCCTTTAGATAGGTTCACTAG
ATTCAATTGTGATTCGTTTTTAATTTGTTGGGTCTTTTTTATGATTAAACTATAAGATTG
GTATTAAGGAGAATGGAGGTGATGACAATTTCCCCAAATGATCGAATCAGATTATACTAA
GCGATTTTTATTTCCTTCTCAACAGAGGAAATCAAGCCAATGTTCTGATCCTTCTCCTAA
ACCTTTTTTAATAATAGCTTCGATTATTTTTCTAGAATAATTTGAGGTTTTAGATTTTTT
TTTGTTTTGGGTTTATTAGGTATATGATGATACTAAACTGAGACAAATGGATTTAAGTTT
GGACTGATTTGGATTTGATGAATTGAAACACATATCTACAAGCTGTATTGACAAGACGAA
ACCTTTGTTCATATCATAAGAGATGATAGTAATCGGATGACGAAATCATTCTTCATATCA
TAAGAGACGACTGTAATTTGATTAACTTATACTGTTGAATGCTAGCTAAATCGGAATCGT
ATAACTTACTCAGTTAATCAAATATCAAAGGACTGAAGCTTATTTTGTAGTAAAAATTCG
CCAGAATAATTTACTTCAATAACCGGAGTAGCTAAACTAAATTTTTATTATGCACCCTCC
ATACCGGTTATAACCTGTAAAACGAATCGATTACCTAAATGTCTGAAAATATAACGCGCC
ATTGCTAAACAAAACGCAAAGCAGCAAAAACTCGATTACACTTACAATGATAAGTTATAC
GACGTCGTTTTCCATTCACGTCTTCATCACCTTCAATAGTTTATTTTGCCGCGGTCAGTA
GCCCGTCACGGCGAAATCTACTTATCGGAAATACGACCGGAGAATTTTGATCCGGAGATG
GAGACATATCTGAAGAACAAGAAGTTGACAGCTTTAGGATTTCTCTTGATTCACGCCATC
GCCATTTTGATCTTCACGCGTGGGTTTCTTCTCACGCGAACAGAGCTTCCTTTCCACAGT
ACTTGCTCCGACGTTTCTCTCTCTCCTTGCCTTGCTTCTCCACGCTCCAATCACGATTCA
AGCTCGGGTCAATCTAATCAGACTCAGCCGAAATGTTGGACCAAACCAGTTGTTGATCGT
GTCATCATAATTGTCTTAGATGCACTCAGGTTTCAAGTATTGCAATAACTGAGATTGGTT
TTCTTCAATTTTACAGCTTCCATTTCACAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved