Arabidopsis_thaliana Locus Poly:SnoR28-2a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR28-2a
Arabidopsis_thaliana
Poly:SnoR28-2a
SnoR28-2a, SnoR28-2b
1001..1100, 1152..1254
2254
CAAACTATAAGTTACTTGAATCACACTTGAGAGCGGATCCAAAAGTAAGTAGGAAACAT
TGACGATAATGGTATTAGGGCTGGGGAAAAAAAAACTGGATCCGATTACCTGAACCGGAA
CCGACCCAAAAAATTGGACCCAAAACTGAACCCGAAGATGTACCCTATTGGGTCCTAAAT
TCCTCTACCCGAAAATACCTGAATATTTTATTCGAAAATCTAAATTTTATCCGAAACCCA
AAATTTTACCCGAAAATCCATATATTTACCTAAAAATCGAAAATTCTGGTATCGGTTCCA
AAAGAGCCTGAAATTCTACACCAAACTTATCTGAACCCGACTGGAACCGAACCGAAACCG
AACTGATAATTTAGATTTACCCTATTGGATCTTAAACTTCTTTATCCGAAGGATTGGTAT
CCGATTGGGTTTTACCCAAATACAAACGGCTTACCCCAATGCCCACCCCTACTGGTATAC
AAGGAGTGTTTGAAAAAGTCATCAAACATACATTGTTATATTCTTCATTTCGACATAATG
AGAAAAAACATAATACAATGCAATACTTAATTTTATACATTCTTGGATTTACCTTTTATT
TATAACATATACATTATACACATTTGTCACATTGATCACTGATCAGTAATACGATGAGGA
ATCATTCTCTATAGACCACCTCGTAGGCTCGTACGTCTACAGAAAATTGAAAAACACTTT
GTTGGTTCAGGTCCATCTTCAATTATTTTTTTACTGGGCAAAAAGGTCAAAATAGGCCCA
AAGAACAGCCCACTTGATAAACCCTAATTTTATTCTTGGAGGATGTAGGTTTTTTCTTTT
TTTTGGTCAGAGCCACCAACGTTCCTATATAAATCACCTAATCATTTCATTAATTCTACG
AACCCTAATCGTTTTTTTTGTATCAAAAATTGTTTTTTCTTGGTTTTGCATGTTAGTTTT
TTTTCGTTCTGATTAGTTTTTATATTATTGGAAAAAAGATTGGGAGGTGATGATTATTTC
CCCAGATGATCGAAGCTGATTATACGGAGCGATTTTATGTTTCTCTCTTTCAGAGAGATT
CCAAGCCAATTTTCTGATCCCTTTTTTTATTTATTTATATACAATCAATTTTATAACTAG
TTTCACATAATTAGATGGAAGTGAGGATTATTTCTCCAAATGATCGAAGCTGAACAATCT
GAGCGAATTGATTTCTCTTTTTTGAGAAAATCCAAGCCTATTTTCTGATCCATCTTTTTT
ATTTGCCTTGTTTGGTAAAACGATTTTTTATATATATTTTTTTGTGTGGTGAGCAAAGAA
AAATTGTGTTAATATAATTCAAGATTAATTTAGATACGTAGTATTTTCTTGTTATTTTAT
AATTAATCATGCTATTACAAAGATTGATGATTTTTAATTGTTTGAGTTTCAAGAGAGGTT
ATTTTGTCAATGGAAGTGGCAAATTTAACTTAGTTTAGAATAGGACTAATGCTTACTGAT
GTAACACGCCAAAATCAAAAGTTATATCACCTTGTGAATTTGTAGTTTGAGCGAGTAGAT
TAACAAATTCTATGATATTCAACATTTTGAAAGCATTATCTGAAGAAAGTATACACATGT
TACGAAATCATAAAAACAAACTATAGTTTTAAAGTTGCAAAACCAAAGTGTCGAGCCACA
AATCAAGCAGCAACCTCGATGTATGGCAAAGTGAAGATTAATCAAAGTATCAAACAATAA
ACTTACAAAGAGGGGCTAGGCTCAGCTGCGAAGTAAGGTAATAGCAAATGAGTAGTGCAA
ACGGCCAGACCTAGCATTGCTAAGAAGGCATATTTCCTGCAAGACAGAGGAAGAGAGAGT
TCATCAACAGGCTACTACTACTACTACACCTACTTGATGCAGAATCAATTGAGAATTTAG
ATACGTATCAAACATGCTCGTGTTCTAATTCCCTTAGCTTGTTCTTATCCATAATTCTCA
TAACAACTACTAGACATTCTCTTGCTACTTTCCAGCTAGATGGAGGCTTAATTTTTACAC
AAGCTTGAAAGTGTTTTAAGATTCAATGTCTGCATCATGTGAAAGTTAGTTGATGAACAA
AAATGTAAAAAGCTAAGTTTCCCAAGGTAGAAGGACAGAACCAAAAAAGCTGAGCCATGA
GAGTGAAGTCTCTTCAACAGTAAACTAGGCTTGTTAACCAAAAGTACATGAAGCTAAGAA
AAACAAAACAAATCACTGATCATGCTACATCAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved