Arabidopsis_thaliana Locus Mono:SnoR77
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR77
Arabidopsis_thaliana
Mono:SnoR77
SnoR77
1001..1134
2133
TTAGTACATTGGAGACTCTAGGATTAGAGATTGAACAATGTGTCATTAGCTGCTTCAGT
GACTTCTCATTGCAGGCTTCTTGTTTTGAGGTACAAATATTATTACACTTTGATTTAGCC
TTACTTGGTGCATCGACAAATTAAATGTATATTCTATAATTATTTTCTGTTATATTCTGT
TTTTTTCGTATATATGTAGGTTGGTGAGCAGAGATACATGGTTACTTCGGAAGCTACTAA
ACAAGCACTAATCAGAAACGCAGGTTATGGAGGAAGATGTCTGTAGGGGAGCTTCAAAAT
TGCAATGTTTTTTAATGATGATAATATTTTCCGGTTCTTCTTATTCTCTTGTGATGAGTA
TGATATTTCATAAGGAGATAGATAAATGGGAAAATCAAAGGTGTAAAAAGAACTCATTGA
TGTTTACCAATTAGTCTCCTCGACTGACCCCTCGGTTTCTAATCCGACTCATTAATAAAA
CATGCAAAATAGAGAGAGCAGAAATGTTAAAAAGAGTTTTCATTTGGGCCCAATAAGCCC
TGTTATACTAAAGCCCAAATAAAGTCCACTAAAATTCTGCCAGCTTTTTGACCTAACGAG
CTCCATCCGTTTCCTCTTTAAATAGCTGCGTCTAACTTTGAACCCTAATCAAGTTATCCG
AGAATCGGCCACTCAAAGCTTATTATCAATCTATATAGTTCGATAGATCTCTGTGCTAAT
TTTTTTTCTTGCGATTTGTTTTTATGGTTTATGTGTTTTGGTGGTTTTTTTAATGTCAAT
CGGGACTGGAGTTTGACTCTTTAGCAAAATAACGATGCCATAGAGATGAATGCAGCGCCC
TAAATAAAAAAGACCACAATCGGAGATCTATCTCAGTTCTGTCCGAAATCGATTCCCTCG
ATATTGGACGCTGAGATAGTTCTCACATGTTTTAATCTCTGCTTGTTTTTATTTGATTTT
ATGAATGATTATGATATGATTCGTAATGGGAGCGGTGATTCAGGCAACCTACTTGTTAAT
AAAACAATGACATGAGAGGTGTTTAACTGCTCCTAGATCAAATTATGCTTCTGCTCTTCA
GACTTGCTGAGATTTTATCGTCTTTGAAGCTGGTCTAGTAGTCTTAAGCACATTCTTTCA
ATCTATATGGCTATTCCACTTTATCCGTCCCAATTCTGATGTGTTTACAGAAACCAGATC
TTGTCTGATTGTGTTTCGTCCGGTTTATTTCGGATTCCTAAAGAAGAAGGGTTTCGATTG
CACCTAGGCCCATTTCTACCGTCTATAGTTATTGTCATTGGTCTACTGGACATGAAAAAT
TATATTAATGGATATGACATGTCTATTTTACTAATTAGAGGAAAATATCTAATGTATCTG
CACAATCCTACATAACATACCAGGCGATTGTGTTATGAAAATAAGATCTTTCAAAAGGGA
CAAATTTCTGTAAGAACGTCGTGTTATGTTATAAAAAAAGAAATTTTATTTTCCCTTGAT
TCCTATAAAAAAAAGAAATTACATAAGGGTTGATTACACATAGGCCCATTTCAAGCCTTT
CTAGTGATGGGTCACTCGACATGAAAAAAGATTAATGGACTTTATAGGTCTAACCGCAGT
CGTTGTAATTCTTGAACATAATAAGATTATCAGAGGATTTATTTTGATCCAAAATTTGTT
TTTATACCTAACTTATCCTATATTCTATATGTTTAATGGTTTATAAAACATAGTTTGATA
GTTTGATATGGTTATGCGTAAATTTTGAATAAAGTTTTATTGTCACCATTCAAACTTAAA
ATAATACAAAACTCATATAATAAAAAAAGGTAAAGACTGTAGACTAAAAAGAAAATAAGA
TAAAGTTTTTTTTTATAAAGACACCGCCACTGAAAACCTTAATTCATTTGGTAGAAAAAA
AACAAGTTTTAAAATTTTGTCCACTTATCAAAAGAAATTTTTATTTTAAGTTTAAAACAT
AACTTTATAATAAAGACACAATTTGTTTTTGTTTTTGTAACTATTTATTCTGATTTAAAA
ATATTATAAACGAGAAACCAGATCAAAATAGCAGATAAAACAGGACTCTTTCATTCGTCT
TCATTTTTAACACACAAATCTTAAATCACTTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved