Arabidopsis_thaliana Locus poly:U14a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U14a
Arabidopsis_thaliana
poly:U14a
U14a, SnoR99, U14b, U14c, U14d
1001..1121, 1218..1320, 1366..1484, 1525..1646, 1691..1819
2819
CTTTGAGTTTGATCTTATATATAATGTCAACTGGTGAAGTTTAATTAACTCGCATGCAT
ACAATCTTACAATCATGTATGGATTCTCACATATCATACTGTTCAAACTTCAGTTTAATA
ATCTTGTTATACGTACATAATATCATGTTTAACTCGCACGTACACAATAATCTTTGTATG
GATTCTCACACCAATTATCTAGAAGGATAGTATAATTAATAACTAACAAAGAATAACAAG
TCACATCTTCCTACTACAGAATATATCCTAACGTTCATCAACTATTATCATAGTTAGTTA
CCTCATTAAAAATTATATCACTATCACATATTTACATATAACCTTTTTTTTACATATAAC
TATTTATTTATTTCATGTAGCATCTTACTTTCATAATTTCACAACTAAAATCACTCTAAA
AGATTATAAATTAATAATAGGGTTTTGTGCAAAAAAAAATTAACTCATCAATTTATACAA
TTTTATCATCTATTTCTAACAAATGAAAAAATTAATCTTATGAAATCTAAAATAATATGC
AATATGATCTTTATTGTGTTTGTTATAGTTAACTTGAGTTGTGTTAATAAAGAAAATGCT
CTCAAAGTAAGTATTTATCTCAGCGCTTTGTTATAAGCCCGTTTTGATACCCAAAGAATA
CACCAAATATTATGGGCCGAACTAAAAAGCAATCAAGCCCATTATTTACTGTTAACATCT
CGATTGTTCTACTGACGCACCGAACCAAAAAAAACAAAATAGATCTCCACCGTTGATCGT
GTCAGGGAGGACGAAACCCTAATCATCGGACGCCTCTTCTCTCTCACTATATAAAGACCG
CATCCTCTACTTCTTCATAATAGGAGCCTCTGTAATTTTGTAGTAGTCTGTCCGATTCTT
CTCAACGATTTTTGTATTCATCGAGTCAATTGTTCCTGTGTTTTCATTGATTAGATCTTG
TGAATATAGTCTTTATAGCTTTGGTTAGAGTTTTCTTATTGGTTAATGATGATAAATCCA
AAGGCTTGTTTTTCAAACATTCGCAGTGGCCGCCTAAGAGCTTTCGCCTTTCGCCAGGCT
TGAGAGTTAATGCTGTTTTATCCTTCCTTGGATGTCTGAAACTTTTGTATCTAAACCTGT
ATTGTTTTGTTTTCTATTAGGGTTTTAGATTTGGGACTAAGTTATTCAATGTCCCATTAG
CAGAATTGATTTCTCTTAGTGCTTAATAGGATTGAACAAAGTCCCTCAAATCTTGATCCA
TCTGTCACTTTGTCAGCAGTCTTAATTGGTTTCTTGCTGATCATTATATGATGGGAAATA
ACATATAATCTCGATTTTGATTAATTGGTAGAATTGCTTAATATTGGTCGATGAGGATAA
GATGAAGGCTTGTTTCTCAAAACATTCGCAGTGGCCGCCTAAGGCTTTCGCCTTTCGCCG
GGCTTGAGAGCTTATGATGTTTTTATCCTTCCTTGGATGTCTGAGACCAATTATGTTTTA
GTTAGATGATTGTTGCTGTTAGTTTTCGGTTGATGAGGATTATATTAAGGCTTGTTTCTC
AAAACATTCGCAGTGGCCGCCTAAAGCTTTCGCCTTTCGCCAGGCTTGAGAGCTAATGCA
GCTTTATCCTTCCTTGGATGTCTGAAACCGATGAATGTTTTAATTCTCGTTTTTATGTTT
TTGTCTGTAAGAAAGATCAATGATGATAAACTTAAGGCTTGTTTCTCAAAACATTCGCAG
TGGCCGCCTAAAGCTTTCGCCTTTCGCCGGGCTTGAGAGTTAATGCAGCTTTTATCCTTC
CTTGGATGTCTGAGATCTTTATTCACTCTATCGATTATCTTGTCTGTTTAGGTTATTCCT
TCTAGTAGATTATTATCGTCTATTTTTTGTGTTGAATTTGCAGGTAATTTCTTGGTGGTA
GCTTCTTCGCTTTACTGGCTTTTGGAGAAAGAGTTCCTTACGTTTCCTGTAATTTCCTTT
AATCTGTAAAAATCATTGTCAGATTTATTTACAATCTGTAAAGAGTTCTTTGTTGTAAAC
AATTTTGTTCATTGGTGATGAAATTTTGTTCTCATTATGAATTTTATTTGTGATGAAATA
CCGTGATTCCTTTATTTATCAACTTTGAAAGCTTATTACTGAAAACTTTGTTTGAGCTTC
AAAGAATCAATGATCTCTGAAAGCTGTAATCCACATTCAACAAATAACACTCTTATATAC
AAAAAAAAAATACTCGAAATTTAGAAATTCTATGTTTACAAGTTACAATAGTTAGGAAAT
TGTAATTTCAAATCAAATAAGCTAAAAAGATGTTATTATTAAAATGTTCAGACGAATTAA
ACCGGACCTAATTTGCTTGGTCTTTTGGCCGCTGACCTTGTCTGATTGATCGGGATTTTT
GTACGGCGAATCAAAATCCACCGAACAAACCGGAAGGCTAGGATGCTCAAGCTTTACGGA
TTGACTTAGAGAGAGATCGATTTGAACTGTGTCATTTTGAGCATGGTTTCTAGAAGAGGC
TCCGAGACAAAAGCGATTGTCTGTGTCCTCACGGATAGAATTAGGATCTCTAATCAATGG
GTTTCGCATTTGTCTTTCGCTGGTCTACTTGGTGTTGCTGGTTTCGTATTTGCCCAACAG
CACGGTCTATTCCGCAACTTAAACAACTTAAAACTCTTCTCCGGTAGAGAAAAAGACTCC
GGAGACGATTCTTTTCTCGTACCTGGCCTTCAAAATCTCGGAAATAACTGCTTCCTCAAC
GTCATCCTCCAGGTAATACTTTGAATTAATTCTTCTTTGAGCTTGCTTTTGATCTTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003075.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved