Arabidopsis_thaliana Locus Poly:SnoR12-1a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR12-1a
Arabidopsis_thaliana
Poly:SnoR12-1a
4
SnoR12-1a, SnoR12-1b, U24-1
1001..1083, 1175..1270, 1321..1414
2414
TGACCTTGATTGTGTAGTGAACTAACTAACAACTATGATGTGATAAAAGGCTGTTGATC
TTGCAAAACGGTTCTGCGATGGATCAGCACCACGCATAATCAACGGATGCCTAAGGACAT
TTGTCAAGGATAGAGCAACAACATCAACACCTCAAGCTTTAGAATTGAAGCAAGAAGTGT
CGGTTTAAATTAGAACAAAACCCGCATCTTCGTTAGGAGGCAGGCAACCTCAAGATGTTG
GTCGTCGGAAGTCGCTAGTAGGCAAAGTGTTGATCCGATGATCTTATATATTCGACAAAG
TCGCTCTCTGTCTTGACAGACCGCTTCTGGTCCGAAGCTTTTGATACCTGAGACTGAATC
TATCCATTGCAGGTCAACATGATTATTGCTAAGAACACAGCATACTCATGTCTGTATTAA
TATATTGCCCATAAGATAGTATTAATTTATGTAGTAGTTTTCATGTTTCTGTCTTTGTAT
CCTCCTCCTTCACTTGTGTCCCATATTTGAGAACAAACAAAGCTGTATAATCAGGTTTTT
CGTATAGATGTTTTTTTCCGCTTATGGTTCCAATTCATGAACAGGGTTGTTTTGCCCCCT
CACGGTACTAATAAGAGAAAAGTGGAATAAATAAAGTAATGGGCCCATCCAAAAAAACAA
AAAGCCCAAGAGAGCTAATGAGGATACGGCAGCGTTTCGTCAAGCATAGAGATTATTAGG
GCTTCTTCTCGTAGTCAAACCTCTTCGTCGCGGCGTATATATATAACTTTTTTCTCTCTT
CTTCTTGATTTATCAAACAACTTCACGGCTTATTCGTTCTCTCTTTTCTAGATTAGCGTT
TTCTTTCTTAGATCTCTTATCTTTTCTGCGAAATTCGATTTTAGTGATCTCATTAGCAAA
GCCTTATCTGTAGTTTTCTTCTTAGTCGTAGATTTGAATGTTTTGTGTTTATTTTTTGGT
TGAATATTGGAACTTTTGTGGAGCAGTATTGATATTGATGGTGAGGATGACGAAAAAATC
ATTCGGATTCCCTTTGAATTCCTCCGGGAAACATGTGATTATATAATCAGCTACTTCTGA
CTCATCATCATCATCATAACACCTTTTTTGTTTTTCGCCGATTTAGAAAACGTTTTTTGA
GGTCTTTTATGACATTTTCTTTGATAAATTTTTTTGATGGTAAAAGATGACGAAAAAAAT
CGTTCGGATTCCCTTTGAATTCCCTCGGGAAAGATGTGATCACAAACCAGCTACTTCTGA
TTTTACCATCATCGATATAGATTTCCCAAAATAAGTTCCACTTTTGAATTGTTTTTGAAT
GAGGCCAGTGATGTAATAAAAATATTTGCTACTCTTGATGAAGAACTTTGTTCTTTCAGT
TGATGATTGGTTTACCACCAAGATCTCTGAGGCCTTAGTTTTCTACTGTTTATCTACCAA
CTCATATTTGATACTCATTATTAAATTAGTTCATCCATAAACTCTCCAGGATATATTAGT
TCAACCTAAATTAATCTTAGATGAGCCTAAACATTTTAAACAATAGCAAATAAACTCTGT
TTCAGTAACTCTAGCCAAACCAGTCAGACTTCGAGCACGGCAGAGGCGAGCTAACCCAAA
AAAAACATGATTAGTTCACAAAATTCTTAACATAACCGGAAGTAAATAGAACCACCAGGT
ACCAAAAAAAGAGCATCACTCGCTGGTACATATGTCGTGGAATCCAATCATCTAAATAGA
TTGACCAAACAGACAATCTTAGTCGGGAAAGTTCTTTAATGAGTATAAAATGACTAGTAT
TGAGAAAGTGTAGTTTTGGTGAATCTTGGAGCAAGAGTAAGTAAAATCAAGGTCTCTTCT
ATAAAGAATGGTTTAAGGTCATTAATATGTGTACACAAATTTTTTGTTGGAATGTCCTGT
GGTTTTAACATTCCTAGTCATCGTAACGGCTTTAAAAAATGGTTTAAGGTCAATAGGCCT
ATTTTTGGAGGCGTCATAGAGAAGCACGTGAAGCAACCAAAGGACAAGAAGTTTATTAAT
GCTCTGCTGCCTGGTTGGTTTTTTGATGAGAACTATGGTTTCTCAGATTTAGGGAAGATA
TGGGTGTTATGGGACCCATCTGTTGAGGTTGTTATTGTTGCCAAATCGTTGCAGATGATC
ACTTGCGAGGTTCTTTTCCCTAATTCTCGCACTTGGATTGTTATCTCTGTGGTATATGCG
GCCAACGAAGATGATAAGAGAAAAGAGTTATGGAGAGAGATCACTGCTTTGGTAGCTTCT
CCGGTCACTTTTAATAGACCTTGGATCTTGCTAGGAGATTTTAACCAGGTTCTTCATCCT
CATGAGCACTCTAGGCATGTTTCACTCAATGTGGATAGGAGGATAAGAGACTTTAGAGAA
TGTTTGTTGGATGCT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003075.7
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved