Arabidopsis_thaliana Locus FIBRILLARIN 2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana FIBRILLARIN 2
Arabidopsis_thaliana
FIBRILLARIN 2
U60.2F
2431..2503
4297
TAAATGTATTAAAGCATAACCATTAATTTGACAAATAGAAATAAATAGTTCAGAATGTA
TAAGTTGAGAAAAGTTATAATGATTGGTAGGGAGAGACTCAAAAAGAAAAAAGGATGGGT
AATGGGACCTATTTTCCCCAACATCCCACATGCACACTTCCCTCTCCATTCTCTCACATT
TATTTCTTTCATTCTAATTTATCCATTCCGTGTGTAACATATTCACTAATAATCTCATCT
CACTAACTCATTCATTGATTGTGATATGTTTATCTAGAATTAGTGTTTTAACACTGTGTC
TACATATGATTTCCTTTTCATTGTATGTGAACATGTTAACTCACTAATCATTTTGTATTT
TCGAGTTAACATGAGTCTCCACTTCGGTAGACTAAAGTAAAGATAGGTTTGAGTATAATA
AAGTTTAAAATTTGCTTTAAAATCAATATTTATAAATAAGTTTTTATCATAAGTGATTTT
TGTATGTTATATTGGACCTTGTATAAACAGACTACAGAAGAAAATTATTTATGAGAACTT
GTAATGTTAGAGTGGACCTCGTATAAACTAATTATGTGGGCTTTTACCATAAACTATTTA
TGAAAATTATTATGGCCCACACCACTATAACTAAAGCCCACATATTTAGCAGCCCAGTTT
CATTGTAAGAGACATGTTCGCTCTGGAACTAGAATTTTCTGGTTTTTGGGTATTTGTTTT
CTTATGTGTAGAGAAATGATGGTAACGATTAAATGTTGTGTATTACAATTTACAATGGTA
AGACGATTAATATATTTACACACAATTTTGTTGTTGCTGTAACACGTTAGTGTGTGTGAT
GATAGAATTTCATAAAGCTTTAACTACGAGGGGCAAAATGTTAATTCTAAATAGTTGACA
GCAGAAAAAGATATGTATACATAATATAAGGATTAAAACGTAAATAATAATAAATAAGGC
GAGTTAAATTAAAACCCTGTTAAAACCCTAGCTTGAAACACATGTATAAAAACACTTGCG
AGCGCAGCTTCATCGCCATCGCCATTCTCTCTCTCATCAAAAGCTTTTCTCCTTGATTTT
CGCATTCTTTAGAGTCTTAACGCAAAGATGAGACCTCCTCTAACTGGTAAGAACCCTAGC
CGCCTCTTCTCTTTTCTTCATTGCTTGCTTATCAGATTAACAATGGCGAGTGACACTCTT
AGCTCGTTTAGTCTTTAAAACTTTATGTCTTTAGCTGAACTGATTGTCAACTTTGTTCTT
TTTTGCTTAGAACTGTATTGGGTCTGCGTTAGTTCTATCGGATATAGAGTTGATGGTTGG
GTTTTATGTTAAACATGGAGTCTCTAATGAATGGTCTTTTGTGTTCAGGAAGTGGTGGTG
GGTTCAGTGGTGGAAGAGGGCGTGGTGGATACAGTGGTGGTAGAGGTGACGGTGGATTCA
GTGGTGGTCGAGGTGGCGGTGGTAGAGGAGGAGGAAGAGGTTTCAGCGACCGTGGTGGTC
GCGGCAGAGGAAGAGGACCACCACGTGGTGGTGCTCGCGGCGGCAGAGGACCAGCTGGCC
GTGGAGGCATGAAAGGAGGAAGCAAAGTGATTGTGGAACCTCACAGACACGCAGGAGTGT
TCATTGCAAAGGGTAAAGAAGATGCCCTTGTTACCAAGAATTTGGTTCCTGGTGAAGCTG
TCTACAACGAGAAGAGAATCTCTGTTCAGGTATTATAGAGGATTGATTAATTGATTGATG
GTTTGTATTTGCACTCCTTTTGATGAATTTGTTTTTAATGGTTCTTGTGATTGAATCTGC
AGAACGAAGATGGAACCAAGACTGAATACAGAGTTTGGAATCCTTTCCGTTCGAAGTTGG
CTGCTGCTATTCTTGGTGGTGTTGATAACATCTGGATTGTAAGCATCAGCTTGTGTGAAT
CTTATTGTTGTTGTTTGCGAGACTTGGTTCATATATTGATTGTTGTTCCCGTTTCAATGT
AGAAACCTGGTGCTAAAGTTCTATACCTTGGTGCTGCTTCTGGAACCACAGTCTCTCATG
TGTCTGATCTTGTTGGCCCTGTAAGCAGAACCCGTCCTTTATGTTGTGATTATCAGGTTT
TAGACGTGTATTGGAGTTTCTTATATATTGCCTTTGTGATCTGATAGGAGGGGTGTGTGT
ACGCGGTTGAGTTTTCTCATAGAAGTGGTAGAGATTTGGTGAACATGGCAAAGAAGAGAA
CCAATGTTATTCCAATCATCGAGGATGCTAGACACCCAGCTAAATACAGAATGCTTGTAG
GCATGGTTGATGTTATCTTCTCTGATGTTGCTCAGCCAGATCAGGTTTGCTTCTTTTGTT
TAACTCACAATGAATGTCTAAATATTTGCCTCAAAAAGCTTGACCCAATACCATTATATG
TGTCCTTTGCTTTAAAATGGTGTTTTGATAATTGCAAATGATGATCTTACTTGGATTCCC
CTTCAGATCATTATGGGTGATGCAATCTCCAAGTTTCTGATGTACTGAAAATTCTTGTTT
TTGTTTTTGTTAAGCTTAATCTTATTTTACTATGTACTTGTTTTACAATTTCGTTTTTAA
GAACAATACTAAATTTAAATGTCTATTATTGCTCGGTTTTGGTTCTCCTGATGTTAAACC
TACTTGTTTTCTAAATGCCATTCAGCTTGTGGGTTGCTTCTAGTATACTTTATACTGTTT
TGTTTATGAAATTTTCTGTGCCATTTAAAACCGTGCAGGCTAGGATCTTGGCTTTGAATG
CATCATACTTCCTCAAGTCAGGAGGACACTTTGTGATCTCAATAAAGGTGGGTAGCAATC
GAAACATTTATTTAATCCATGATCTCTCAAGAGAGAAAGATTAGTGAACATGTATTGTCT
CATTTTTGCAGGCAAACTGTATCGACTCCACCGTTCCAGCAGAAGCTGTGTTCCAGACTG
AAGTGAAGAAGCTTCAACAGGAGCAATTCAAACCAGCTGAGCAAGTGACGCTTGAGCCAT
TTGAGCGTGACCATGCATGTGTCGTTGGTGGCTACCGTATGCCTAAGAAGCCAAAGGCTG
CTACTGCTGCTTAGAAGTTTTCTACTCTACGCTCTTCCCAGTACCTCAGATTTTGCTTTG
TCTCGGTCTCTTTAGAATCTGTATGGTTTTAGGGTTTATCTTAAATTTTGAGCTTTGTAA
TCATTTTGAACCCTGGTTATGTTCACTTGGCTTCCAGCGCTAACTTTTTCGACAAGTTTT
TGATATATGGAACAATTATAATAGAATTTTGTCGACTGAGGTTGATTTCTTTAAATAATG
ACACCTCGTAATGCAAATGTAAAACGCCGCAAGAATTTGCACACAAACAAAACAAAGTTT
GAAGACACGTTGCATTTTTAGGACACAAGCCAAGGAAATGTAAATACAAAAAGCTCACGC
AGAAACTGTAACAAAAAACTAATGTCAGAAGTGGGGTTTGAACCCACGCCCTCTTACGAA
GACCAGAACTTGAGTCTGGCGCCTTAGACCACTCGGCCATCCTGACCTTCTTTATTAAAT
ATCATTGACAACATATATAGCAGGATGAAAAAACTAGAATGGCTTATTCTCAAGCATCTG
GAATTTTATTTGGGTTACAAATTTTTTTGATACATTTGGGTTACATGAGGAAAAGTAACT
AACATTTGTAATGCAATTTTTCCTTTTGGAAGTAAGTAACAAAACATAACTGATGGAACA
GTTTCCTACAATCTAAAACTCTAAATAGAACAATTTGGTGCCCAAACCAATGAAAGACAA
ACAAAAAGTCACTACTAAGCTTAACAAAAAAAAAACATCAATCACGCAAGTATATCCTTG
GATGTCGTCTCACTCCCTCCCCATTTCTTCATACGTTCCATCGTCTCCTCCACCTGTTCA
TCACAGTTGAGATCGATTCAATTCAAGGAATGAAAAAGTGTATATAACAAACATGGTGTT
GTATATCTGGTTCTTACCTCTTTATTCCAGTTTGTCTTATACAGAACAATCAACAGTAAC
AACGTTTGAAGCGCTGTCCCGGCTATCATTCCAGACCAAAGTCCCTGAAAACATTATACA
TAAGTTTTAGCTTCAGCATTAACTGACTTAACTCATGCCATTTTCTAAATTCTCTAACCA
TCACTCCAAAGTTTGCAATGTAACCAAGAAGATATCCAAAGGGAAGGCCAAAAATGTAGT
AACAGCCCAAGTTGATATAGGCCACTAAGCCTTGCCAACCGCCTCCAACAGCCACACCTA
AAAAGATGAACAAATCAGGACGGTTATAATCTGATGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1125, 1368..1708, 1802..1897, 1982..2059, 2147..2323, 2738..2806, 2891..3297
1107..1125, 1368..1708, 1802..1897, 1982..2059, 2147..2323, 2738..2806, 2891..3073
NC_003075.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved