Arabidopsis_thaliana Locus poly:U49-3
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U49-3
Arabidopsis_thaliana
poly:U49-3
U49-3, U65-3, SnoR77Y-3
1001..1127, 1159..1311, 1360..1388
2388
ATTCTCTATTGCAATTATCTCTTTCGATTCACTTTTGTCATCGTTGTCTCTTTATATGA
TGTGCTTAGTTTGATGAGTGTGAGAAGTACAGAGTCTCTATCTAATGTTCAGTCCTGTCA
ACATCTAATGGTTTTAACTTCTTGACAGTGTGTGATAAACAATATCACCTTATAAGTGTG
CCAGTAAAGTGCAGTGCGAATTTGAAACAATGTTTTAAGCACTTTCAAAAACATGTGCAA
GCAAAAACAGGGGACAATACAATGAGATGTAGAGGAGACTGCAAGATGCTGAGTCTATCA
GCAAGATCCCCAAGTTCTGATATGAACAGAGCCTTCTCCTTCACTAAACTCTGATTTGTT
TGATTCAAACTCAATTTCCTCTCCATCTGCAACATTTGTAACACAATTATACACACTTTT
CTTAAAAAAGAGAGGAAAAACCTATAAAACAAGAGTACATGAGAAGACAGTACCTTTCTC
TAAGATTATATGCACAACACAAAACGGAACCGCAGCATAAAGATCAACTCCTTGCAGCGT
CATCCAAGTGGTTTCCCTAGAGCCATGAGATCCACACGTGGGACCACATTTGTTGAACCA
ATGGTTTGGTTTCTGTCCCAATCATCGTAGAAGGAACAAAGACTAGTAGTCTTTGTAGTT
AGAGCTCTTCTCTTTCTACTACCACAATCTACTGGCCCAATAATATTTTATTCAGCCCAA
AATACATATAGGCTCTTAATGGGCTATATGGTAACTCGATCAAACGCTTGGGTTTGAAGT
TATGCCGCCTCGTACACGTTAGGGTTTCAAGTTATATGCCGCCTCGTACACGCTAGGGCT
TTAAGTTATGCCGCCACAAATACCCTCTATATAAATACAGATTCTCTTCTCCCTCTTTCT
CATATCTTCAACAACGTTTTCTTCTATCTTAGTTTTTTCTTCTTTTGGTTCTCTGTTTAC
TTGAAATCGTTTAATGTTTGGTTACGAGTTTTGATTGTTATAAACCCGATGAAGAAGCAA
TCCCAAAAGATAGGAAGTGCCGTATGACACTTTACACAACAGCTAGCGTGACTGAATTCG
TTCTGTGTCTGCTGTGTGGTTGATTTGACAAGGGTCCGCTGAGGGTTTTTTCTTTTTGTT
TTCTTCTAAATTGTAGAAATTGTCTGATGCCACGTCGAAGGTAGCTCTTTTTTTTGGGGC
AATGATCCTAACTCGACGCTATATTAGACATAAACAAATGTACGTGTTTCGCTTACTGAT
AGGAACCTGTGGATCTTGTTTTACGATCTACGGAGCCATAGCGATTACAATTTTCTTTTT
TGTTGAAAAAACTAGTTTTGATTTGGTTATTGGGGAGATTACCGATGATGATTTTTGCTA
ATCTGTGTGTTTTAGGCAAGTATTTCAGTTTTGAGTTTGGCTTATAATCATGTACCAATT
TGAGCTTTGAACCAATTCGAGTTTTGTTTAAGTATCAATTAAACCAAAAAAAAAATGGTC
AAGAGATTGTGTTAATGGTTATTGAACTGGCATTCTCACAATGAAACATGATCTTACTGA
AATAAAGTAGATGAAGTTTAATTTTGACCCAAAAAAATCTAGCGACCACTACCAAAAGAG
AATACCAGAAATTAATGTAAGTGAATATTTAGGGTATGACTAGTAATTAGGAAGGAATAA
TCTGATGATTTTGTTAATGGACGAAGTGTAGAACTCTTCATGGTTATCTCCTCTGAATGA
TCTAAACTTGACCCACCAAGCCATGCCTCACACTTTAACAAACAAACAAAAAAAAGCCCT
TCTCTGTCTTTCTTTGGACAAAGCATTGTGTTATGGTATCAAAATTCCTGAGAAAGAGTT
ACGAAAACCCCTAAAAACACACACCAAAAGTTACTGCAGAGAAAATATCAACTCCTGGAA
GCATCGTCCCTGTGGTCTTTTACTAGAAGTCTAGAATATTGTGGATCTAAAGTGATTAGT
GACTTAAATTTGATAAAAATAGCTTTGAGTTAAAAGTAATTAGGAAATTAGTTTTACATC
ACATAGAAAATAGAAATCTAAAGGACTTCTATAAAAAATTTGTCCATATATATCTTTTTT
TTTTGGAGAATGCCAATTTGGATCAAAATACCTCTACTCTATATTTTAAGCATTTTTGAA
AAAGTTTAATCTTGATAACATCTTCTAGAAAAAAAAATATAGTTGATTTGAAAAAAAAAA
ATTGTTATTTAGTTGAAAAAGTTATTTTTTTGATAGATAAAGTTTTGTCTAAATTTCTTA
AAAAACGATTTCTAGTGATCTACTTAGTTTATAATTTCTATTCTAATATTTTGTACATAT
TCTACGATATTTAGACAATTTTTCTTTCTAACTTAGAAAATAGGATATT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003075.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved