Arabidopsis_thaliana Locus poly:U36a-3
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U36a-3
Arabidopsis_thaliana
poly:U36a-3
U36a-3, U38-3, SnoR6-3
1001..1089, 1132..1208, 1238..1355
2355
ACTCGAGATTATTGTCAATCTTGATTTTGGGAATGGTGAACCAAAGTTGGAGAAACAAC
ATAAGCTTGTTGGTTTCAAGTATTTCTTTAGATATGATGGACTTTGGTTCCTGCTTTATT
TGTTTACGAAAACACATTAAAGGCTATGCAGGGCTAGTTATACACTAGTAAAAATTCATA
CATGTATATAATTTTAACAAAATTAAGGATTTAAACTTTTAAAGCTTTCTCTATTCTACG
AGCGAAGAAAAAAAAACACATTTCACAGAAAAAACGAAGAAGCAGATGAGTAAAACGGTG
ATAAAAACAAAAATCAAATAGTGCAAAATGAATGATGAGAGGAGAAAAAACCTTGAGGCC
AGGAATGTAAGAGAGATACGATCGGTGGTTGTCACCATAATTTCCTCGACGGCGACAGGT
TTTAGGGTTTCGGAATAAACAAAATTAGCGAGTAAAAAATAATAGTAGTATCATGAAAAC
CAAGCCGGTTTACAATAATACCGATTACGAAAAGGCAAATCAATTAGACGTGGGGATAGT
TTTGACACTGGGCTTTCGTATTGTCAAATTTGAAGATGGGCTTTTGTACAAAGCCCAAAT
ACTACAACATTCGGTTACATTAAACCGACAACAACGGAAAGGAAAGTCAATGAACGAGGG
TAGATACGACATTTCAGAGACGGTGTTTTAGGGCTAGGGTACTCTCTATATAATAGCCGC
GTTGAATCATATATACAAATCATTCTCAACCTCACGATAGCTTTTAATTTAGGGTTCTTC
AGTTTTGTTTTTGATATATAGATTTAGGGTCTCTGGTTACATAGATTTCCGCAGGAGCCT
CCCGGGCTAGTCTGATAATAATTCATGAAGAATTAAGCCCCAAAGCTCCTGCTAGATTGA
TGCCATTCGTGTTGCAGTTCTGTCTCTTTTTATAATCCGGCTTAACTGTGTCAAAGCAAT
GTCTAGATTTTGTTATTCTCTGTGATGAATTTGTGTTTTTGGGCTATGATTACAAAATTA
TCCGCGCTTCTGAGACTTAGTTCTATGAAGTATATACGATAATCAATGGTTGAATTTCTT
AATATGAGCCTCTTAAAGTTTCTTCTTTGTTGTTTTGTTTGTTTGTATTGAGGGCAGTGA
TGATTAAAACCAGTTCTGCTTCAGATAATTCCTGATCGAAGAAACTGTATACCAAAAAAC
TTCTGAGCCTTTTTTTTTTAGTGATATTTCTTTTTGTTGGCTGATGATGATATAATCCAA
TTTCGAGGTGCAGTGGAGCTGAGACCCTGTTTTACAGGGAGAACCCCTTGGCAGAAACTG
TAATTTCTATGAAGTTATATGGATTTTGACTGAGGCTTTTTATTACTATCTTACACTTTG
GTTTTTGGTTTTACTTGTTTGAATACGTTTTCTTATTCAATTGTGAATCCAATATGTCGA
TACTAGAAATCTACGATAGATAATACATCAAAAATTATTAAAACTATTTTTGAGTACCTC
AAAAATTGGATGTCTTAACGCATCAGTTTGGTCTCTGGTGATTGTGTTATCTAGAGAATG
GGTTAACAAATTATCAGACGAACATGACTATAATATGAGATTTCATTAAAACATGTTGAA
AGACTAATTATTTGTTCTCTACGAACAATTTATCTTTGAACGGACTGGTACTGTTTTGTT
AAAAAGCAAATTTTGATACAAACGCCGGTGTGTTAATAAACAATCCTCTTGATAAATATC
TTCCGTTTTGGATCATGTGGCGACTCTGGAAATCAAGAAATGAGTTTTTATTTCAACAAA
AAAGTCGATCTCCAGACTGTGAAGCGAAGAAAGGTATTCAAGAAGCAGAGGAGTGGCTTA
ACGTGAATGAGCCCTAGGAAAATACAAATGAGAATGCTGCACCAAGTGATATACAACCCT
CAATACGAAATCGAAGCAGTCAGTTGGAACCTCCCCCTGTTGGCTGGGTTAAATGTAACT
TCGATATGGGTTTATGCAAATGTAACTTCGATAGTGGGTTTATGCAAGGAAGTCCTTATA
CACGTTCCGGTTGGATAATACGAGAGAGTAACGGCCATACAATCCTATGTGGAAGTGCGA
AACTACATCCATCAACAAGCTCACTACACGCGGAGGTTCTCGGGTTTCTCCATGCCTTAC
AAGTGATATGGATTCACGGATTGCGTTATGTTTGGTTCGAAACCGATAACAGAGACCTTG
TAACGTTACTCAACAATGACGAGGATCATCGCTTGCTTGGACCTCTTCTTTGCGATATAC
GTTATTGGATGCTAAAGCTACCCTACTGCTCAATCGACTTTGTCAATCGGGAGAGAAACT
CTGCAGCTGATACAAG
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003075.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved