Arabidopsis_thaliana Locus poly:41Y
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:41Y
Arabidopsis_thaliana
poly:41Y
4
SnoR41Y, SnoR36
1001..1089, 1148..1255
2273
TTTTCTCTCTACTGGAATCCCATATTGATCCATTCCTGGTTCACGTAGAATTCTATGCA
TATCATTATACCATAACATCACAATAGAAAAAGCTTGGTCGTTCTCACAAATAAACGAAG
CTCTATACCATTTTCAAAATCGATCGACCTAAACTCGTCTCTCTTCCAGATATTCGAAGA
AGAGCTCTGAAACTAACTTAGCTAATGATTTTTAAAAAAGAACTCAAATCAGCTCTCAGT
AGTAGAAATCAAATGCGTATACCTTCACAGAAACGAAATCAGATTGACGGTGATTCAGAT
CGCCGCCGATGAACGGAGGAGTCAAAAGTGGTGGAAGTGCGACATTTCCGATAAGGAGAA
GCTCGATTTAGGGTTTGGTTTCCCCTTTATCTTATTTCGTATGGATCGGAGGAGTGTTTC
TTCTTTTCTCGAAATATCTCTCTCTCTCTGAGTACTTGTTTCCCGAGAAACCCAGAGTCG
TCGAAGAAGTTTTCTCATTATCGCTTTTGACAAAACGGTTGCGTTTTTAATAAACCTTTG
AAAAAATGGACCCAGAATAATAATCGGTTTTTGTCTGATATTTTCTTGCGCCTTTTCCCG
GAAAATTTCTCTGAAACTTCTTCTTCTCTGGCTTTTTTTGTTCGTCTCGGTCTACGTGGC
ATCATGTATAACGGGTCAAACCCGAAACTAGATACTCAATGGGCCGAGTTTGATGTAATT
CACAAAGCCCAAACTCATCGGGTTAACGGGACCGACCCGATTCTTTCGAAAACGTAAACC
CTAGCTTCCTCCATTGTCTTATATATTGCCGCCTGTGATTACTTTTCTCAATCAACTCAT
TCTAATGATCGATTATTCCACAAAGTAGTTCTTTCATGTTTCGGTTTTTCTCTTCTTTTT
TCGTTGCTTGATTTGGTTCGATGGTTTTCAATTTTTGATTTTCTCTGAAGATTTGAATCC
ATTTTTGTTTTCAATTCGATTTCGGCTAGATTAGGGTTTAGAGTGAAGGCAGTGATGATT
AAAAACTACCTATTTTATGAGTAATTCTCTGATTAGAAAATTTACCAATGGATCCTTCTG
AGCCTTCACTGCTTATTTGTATTCACAATTCAGTTTTCTCGGGAAAATTAGGGTTTGGTT
TTTACTGTTTAAGATTGATGACGATGAGAAAGAGCCGATGGAATGATGATAACGATTTTT
CGGATATATTAATTTATTCTGTCGACCAAAACTCAGACTACAATTATCTGACTAATTGGC
TCTTTCTCTCATTAATCTGTTATTCTTAATTTTAATCTTCTGTTTTTGGATCTCTTAATT
ATGTTTTTTGAATGATTTGGCTAATACAAGTTTGAACGACTTATGAACGATTTATGAAGA
GCACTGTCTATCACCGTCTTAATTTAGAGACTGCTTACTTAGTTCGGTGACGAGTAATGT
GGATTCAATAAACATTCACAGTTATGAAATTAGAAAAGACATAAATAATTTTTGACCTAT
CATTTAACAAAGAACAAATCATAAGAACGATAATTAAACGGCTGTTAACTCTGTATTTGC
AAGTTGAGATTGTGGCCTTAAACTATATGCTGGGTTCTTTTAGTTATCAAAAGTAAACCC
GGTTATCCATCCCAACCGGTTAAGATATCGGTTTAAACTGAGAGTACCAATAGGAACAGT
ATATAGTGTTCCCTTTGTAAACAAAAATTGTGTACGAATAAGAACAGTATCCACATTCTA
TCAATCTTCACAGAAATGGATATTGTATACCAAAATCTCCAATTACCGAAGCAGTCCAGT
TTAGCCAGTGTTACTGTTACTAAATTGAATCAGATTTGGAATTAGTCGAATAATGATGAA
GACAAGACTTGTTTTTGAAAAGCCTTGAAGCCAATTGAGACAGTAATAACTTTATCCATT
CATTCTTTCTTTTAGTTTATTATCTCTGATGAATCTGTTGTGAGTTAAAAATGAAAATCT
GTGTCTGAACAGAGTATAATGCTAATTCAACCATGACAAGCAAATATTGAGGACCAAAGA
ACCATAGTCTTATATATGGTTTAACGCCATCTTTTGTTTTGGTTCCAATATGGATGAGTA
GAAGAATCATGTTTCCTTGATGCTTGTTGTTGTTGTCCCCTCATGTTAAGCTGGTTCCTA
CTTGGGCTATTATCAGGACTCCATGATTCATATCCTGGATTGCTACTCATGTACTGGCTA
TTCCCTTGGTATGAAGTAACTTGTGAAGCCGATGCAUNTRANSLATEDREGION
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003075
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved