Arabidopsis_thaliana Locus poly:SnoR18a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR18a
Arabidopsis_thaliana
poly:SnoR18a
SnoR18a, SnoR18b
1001..1085, 1179..1272
2272
TTAACACAAATCAACATGATTCATATGTTTATATTTCTTTAAAAAGAAGAACCAATATC
CAAAGCAACTTATAATTATTCTTTTTATATATCCTTTCCTTTACAGAAACTATAATGATG
TTTAATTAATTAATTACGATTTGGATGAGTGTGGTGGTGTTAGATTAGGTTTGAAAACCC
TAAGGTAATCTTATGTTGTTCTAGCAATGGAAGTTAAACTGCTTCCACTGACCCTTTATC
AATCGGATGTTCCTAGAACATATAATCTTTCAGACAATGTAACACACACACATTTGAACG
GATTTTCCTAGAAATTTGTCCTAGATATCTAAAGTCAATGCATTATCAAACTAGCTCATG
TCAGGTGACTAAAATTTTAACTAACTTTCAAATTGGATTTCATTGCTCAATCTTGCAAGA
GAATATGTGTTTATACTTGTCTTTGTATAATGTCATCCTAAAAATGGTGGTCTCACACAT
AAGATCTCGATCATCTTTGACAAAAGATTTATTTCCTTGAAAATGTAGTAAAAGGAATTA
TTCCACCTTAAATTCACCATTGTTTTTAAAATAGTCAAAACTGTCACTAGCAATGGTTCC
AATTTGGATCACCACTATACCAAGAACTGAAAAACACATTGCACGAAGACACATTATCGG
CCCATTCTTAAAGATTCATGGTTAGAAACTTCTGGACTTAGTTGGGCCTATTTTCGGCCC
ATACAAAAGTCGGCCGAACCGAAAGAAACAATTGGGTATTTACGTCTTTTCACGAAGGAA
CCCGAAAGAACCCTAATTATATCGTTCGTAATTGTGTGTATATATATAGATTCCTCCAAG
TCAACCTTGACATCTCAAATCTCACATCCTCTCGCCGTCTCTGTTTCAGTCATATTTGAT
AATTTCCCGATTTAAAGGTTGCAAATTTGTTCGTTTCGTTATTGTGTTCTTCTTAGATTC
TCTGTTTTCTGAAAAAGGATCGATTTTTATGTTTGTTTTGAAGAGATATGATGATGGAAT
TAGATTTCCCTATTGGTTTGATCGCCGTTATGATGGCATCTTACGTATTAGCTCTATCTG
ATCTCTCTTCTTCTTCAATTTTTCCAATTACATGAAAAAGTCTTGAGCTTTTTAATTTAT
TTTAGATAATGATTAACGGGTCTTAGAGATATAGAAAGAGAAGAGAATGAAGTGATGATT
GAACTTTGTTTCCCTATTGGTTTGATCGCCGATATGATGGCATACGTATTAGCTCTATCT
GATCATTCTCTTCCCTTTAACTCTGTTTTTTGATAATTATTCTGTTATTCTCTGTTTAGT
ATCGGATTCTTACTTCCAAGAACTATGTATGAGATAAAGACAACCATAAAGAGTCTGAAA
TAAGTGGATGGTTACATAATCTAACGATTTATGCTGCATAAGCATATTATGCATTGAAAA
TTTGGAGCTTATGCTGCTGAAACCTCTTTTAAGCACTCAAACATTGACTCAGTTTGAAAT
ATATCTGGAATCTCGAAGTTCTAATGTCGATGTAGTGGCCTTGAAACAGAGTACTGCATA
TCTTACCTTCAAAAATAGAGTACTACTGTACTGGATAAAGGCGACAATAAGAATTCTGGA
TACTTGAAACGGCTGAACATAGGTGGATGGATAGTTACATAATCAAACGCTTTAGGCTGC
ATAAACATAAATAAATATCACTACACCTTCAAAGTACTATTGTTGTTGTGGTGGCCTTGA
AACAGGATAATCGACATATTGCAGCGTCAAAAATTATCACAAGCAATGAAACTAAGGGGG
AGACAGAATCACGAAAACTAAATTAGTGTACCAAATAAATAATCCTCAGCTTCTTATAAC
AATTGAAAACTAGCGTTAAAGACAGATTTTTGCTAACATCTATAACCAAAAAACTTGCGT
TAAAGGTCTTTACAATGGGAACTTCTTATTTCATGGGGAAGTCTCTTATTTTGAAACCTA
GACAGCAAACGCACAGTACCAGAACAAACGTAGTAGAGAACGTAAGTCTTCAAAGAACAT
CATCCAACGTTAGAGGAGAACCTCTGGTGACCAACAACTTTGACTTCTCTCTCTCCATAA
GAGCTTCTATATCTGAGCACTTCTGCTTAAAAACTTTCATTTCTTGCATACGAGTTTCAC
CAATCTGTTCTTCCTTCTTCTTTTCCTTAACTTCCTCCAGCTTCTTCTCCAACCAATCAA
CCTTAAAGCCAGAAAACTTCAGGTATTGTAACGCATTGTCTCCTCCCACAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved