Arabidopsis_thaliana Locus poly:U15-1a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U15-1a
Arabidopsis_thaliana
poly:U15-1a
U15-1a, U15-1b, SnoR7-1
1001..1085, 1152..1236, 1290..1362
2367
CGGAAGGAGAAAGACAGGTGGACGCTGGGAAATGGAAGAAGACGGTTAGAGAGAATCAG
GTGCTTCGCTTGGATATGGATACGATGAGGACGCGTGTTCATCGGTTAGAGAGAGAGTGC
TCGAACATGAAGAAAGTGATCGCGAAGATTGATAAGGAAGGTTCATCACCGGCGACGACG
ACTGATCGGCCGAGAAGTTGGTCGATTACCAAAAAATTCGGATGTAAATTCAAGACACAG
GTCTGCGATTCACACGAAGCAACGATGGTTGATCATAGATCACGACGGTCTTGAATTGTT
TTCGATTGATTTTACTCTTTTTAGTACAGAATCAGAAAGCATATTGTTGTGATTCTTGGA
TTTTAGTTTTTGTTAATCCTTCGAGATTCTTGCTATGCGACTGCTCTACACAAATGTGCA
TCGTTTTGAGTCTTGTACTCGAATTAGTAAAACCAGAAATGACATACGGCACAAAGCCCA
TCGTTAAACGTTTCGAATTGAGCCCTTTTCTCGACTTCCTCCGAATGGGCCGTAACAATG
GGCTTCAGTTGCCCTTATCTATCGTAAACTGGGCACTGTTTTGGAGAGAAATTGTTTCAT
ATTTGTGGAATGTGCGCCGTTTTAACGTAGGAAAAGAGGGACGAACTACTCGCTGTTCAG
AATCGGTAGTAGGACTTCATGTCGTTTTATAAAGGAGAGTTCCTAAAAACCTAAACCCTA
CTTTAGTTCTACTATATAAATCAACCGGCTTTGGCTGAGAAGAAGCCATTAGCACAATCC
GAGTACCGAATCAAACCTAAGTCTCTGTAAATTTCCTCGTTTTCCGTAGATTTAGTTCTT
TGTCATCCCATCTTATTAGGGTTATTCGTTTAATTTCGTTTGAATCAGTTGATACTCTCT
GATTTTCCAATATGTGTTTGAATCGGCATATTAATCTTTGATCGACTCGATTTTGTGTTT
TTAGAAAATAATTTAGATTTTTTTAGAGAAGGAAAAATATTCTCAGTGATGAAGAAACAA
TAGATGACGAGTCCGATGAAATCCATTCATAAAATCGTGGGGACAAACGAGGCATTTGTC
TGAGAGGATTATTTTTCTTCGTTTTAGCATTCTAAAATATCTAGGTTTTAGGAACGTGTA
TAAAGGGGATTTCTCAGTGATGAAGGAACAATAGATGACGAGTCCGATGAAATCCATTCA
TTAAATCATGGGGACAAACGAGGCATTTGTCTGAGAGGAATCCTTTTTGTTCAATTAGTT
TTGTTTTAATTAGACTTAGCAGGAAGAAGAAAGGCATGATGAGGATTGTTTTATTGTCAT
CTGATTCTTATTGATGAATCTATACCTCCTACTCATTCTGAGTGCCTTCTCTTGCTCTTA
ATTTTCAGTCACAGATATCATTGCATTAGTAGTCACTAAATTCGGATTCAATTATATTGA
CTCTAGGGAACACTACATTTCAAGTGAATCTACAGATACTCTAATAATATAACACAATCT
GCTAAGACCAAGTGATAAACCAATTGAACTAACAAAAAAAATAAGTTTATGAAATCATAA
CTATTTCTTGATATTAAAAAATAACAGCAAAGATGCCAAGTTCATATAACATAAGGCCTT
CAAGGAGAAACCATAACTTGTAATTTCAAACTGTATACTGGAAAGCAGACTGTGCTCAAT
GTGGTTTTGGATAATTCCCTGCATCCTAGTCCTGAAGTTGAAGCAAAACCTCTAGTATTG
GCATTCTTACATATGATGAGTTAATTTCTGAGAGGGACGTACATTCTGATTCAGGCTCTA
AAGGATCGATTAAGATTTTTAATTTATCAGGACCAAATCAGAAAAAATTTATATGATTTC
TATCTGTATACTTAGAACAGCATCCATAAAAGAAAAATGTTGTTGAAGATCAATTGGACA
TTGGACAAAAACCTAGTGGGCCGGGCCTTCTTTGCATCTACTACTTGAAAGCCTTAAAAA
AGAAAATTAATTGAAAATTAAATTTTACATTTAAGTGTTAGCATCCAAGGCCCATTAGCT
CAGTTGGTTAGAGCGTCGTGCTAATAACGCGAAGGTCGCAGGTTCGAAACCTGCATGGGC
CACCTTTAATGTTTTTACAACATAACAATTTTTGATTATTTTATACTATTATACAGGTCA
GCACCCCTGACTGAGACAGTATCCATATCTCCACTTCAGATTTCGACACGTGGCAACAAA
AAAAACCAGACACTCCGATTCCCACGAAACAAACCAATCAAAATCGTTGCCTTATCCCAA
TCTTATCTCAGCCCTTTTGATTATTACTCTTTAGTCTTTACTTTGCTCACAGCTTTGGAT
CACCAAAAAAAAAACTCAAGAGAGACTT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved