Arabidopsis_thaliana Locus poly:U15-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U15-2
Arabidopsis_thaliana
poly:U15-2
U15-2, SnoR7-2
1001..1082, 1175..1255
2255
AGATGTCTCGAGAATCTTTAAAATGCTTTGAGGCAAATCTATACTAACATTCAAGTCAG
TGTAATTGCTGAAACAAAATTAAAGTCTCACACTTTTGTTATTGTGGTTTTCAAAATGTG
CAGATTGGCTTGAGATGCCAGGTTCTCTGATCCTGCTACTGGTAGTTTCTCCACACTTCC
TTGCTCACCATATACGTGGAACCTGGATAGGCACTGTAATCAGCCTTTTCATTGGATGTT
ACCTTCTTCAAGAACATATTCGAGCATCGGGTGGATTCAGGAACTCATTCACACAGCCCC
GTGGAGTATCAAACACTTTAGGGATCATTCTTCTTTTGGTCTACCCTGTCTGGGCTCTAA
TCGTCCGTGTCATGTAATCCACATTCCTCTTTCATCGACAAGTTGTTTCTTGCTCGGCTG
CTCCAATAAACTGCGTGAAACATCGAGCAGAGCAAGTCTCTATGGTGTTCCTTTCTTCTG
ATTATGTTGCATACCCAAATACTACCTCAAGCTCAATCAATGTTCTATGTATAAAAAAAT
CTCATTTTTCAACTATTTGTTTGTCCTACTATAAGAAAAAGTTCTTTATTGAATGATTGT
AAAAAAAAAACTAGCCTTCATGAGTTCATGTTGTTTGCCTAGTGTTGAAAAATTACTCGT
GACTTCCGTTTCGAGTATTCACATTCGCAATACGTGGCGTTTTCAATAGGAAGAAAACTA
CACGCTGTTTGAATTTTATAACTAGACTTCATGTCGTCTAAAAGTAGGGGGGCGGCTTAA
AACCCTAACCCTAGTTTGGCTGACTCCTTATAAATACTTCTCTCTCCGCCGTATATAATC
TTAAGTCATCTCTGATCTCCGAGTGCAACTCAAATTTGAATCTCTGGCTTCTTAATTCTT
TCTGATATTTCGTTTTATTGGTTAATCTGTTTTCGATTTCATATCATTAGTCTAGTATTT
GTTCTTCTTTTTGTGTTTGATTATCTTAGAAAAAAGGGTTTCTCAGTGATGAATACACAG
ATGACGAGTCCGATGAAATCCATTCATTAAATCATGGGGACAAACGAGGCATTTGTCTGA
GAGGAATCCTTTTATACTTTTTTCAATCTTATTAGTTTTTTCTGCTAAATGTTTTTCAAA
GTTGTTTGATTCGTGATTCTCGAAAATTGAAGAAAAAAAGGCATGATGAGGATTGTTTTA
TTGTCATCTGATTCTCATGATGAATATATACCTCCTACTCATTCTGAGTGCCTTTTCTTA
ATTTCTTACCATGAAACTTCGTTGAGTCTATAAACTTTATTCGTTCTATAGTCTAAATTA
TTGAATTGGATACTTATCAATTGATCGAAATCTAGAAGTTTGACTGTCTCAGCAGTTTTT
GTTTTTAAAACTAGGAAATTTTTGATAATCTGTGCAAGCTGGGTCGGATTCATAGCTACT
ATTGTGTTCTTGGTTCTGGAAATTATAACTGTTATGTTACTATTGTGGATGTGAGGACGG
CTTTTCATGGATGTACTCTCAATTCTAACTATTTGACATGGTTGCGTAAGAATCAGGAGA
TGAATGTACTGAACCTAACAGATAAACAACTGATCTTTAGAGAAGCACTGCCCTAGATGT
GTATACCTCGAAGTCAATCGATGATACTTCTCTGAGAAATCACTTGTAAACTTTGATTTT
GTATTCAAGAATCTTAATATAATAAAATAAACTCTTTATTCATTCGTTGTGTCTTCTTTC
TCATAAACAACCTTCATCATCACTATTGAAATCTTAATATTAATGATATGCATAAGTGAT
TTCATTCTGCGATTAAAATGTTGTGATATGAGAAGCATAATAACCGAACATTTAGTTATC
CTTTCTCTGGTGTATTCCAGACCGGTCTTGAACCGTTTCTAGAACCAAACTATTTATTCA
ACTTTATATATTCCAGTGGAATTGATAACATTATAATCACGTCATCAATACTGATTGGGA
CAGTATCTCTATTTCCACATCAGCTTTAGACACGTGGCTATTGATCGACCATATAGTCAT
GAAAACAATCCAATGGAAAATTTTCAAAACTTATCCGACCTTATCTTAGCGAAACAAAAT
CTCTCCTCTGATTATTACTACTCAACTTCGCATTATCACTCAAACAAACATATTGACATC
TGAGTCTTGTCATCATGGCAACTTCTCTCCAAGCCGCCGCAACTTTTCTTCAACCGGCGA
AGATTGCCGCTTCTCCTTCTCGTAATGTCCATCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved