Arabidopsis_thaliana Locus poly:SnoR88-1
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR88-1
Arabidopsis_thaliana
poly:SnoR88-1
5
SnoR88-1, SnoR19-1, SnoR20-2, SnoR38Y-2
1001..1139, 1188..1265, 1340..1426, 1483..1566
2576
GGGTCGAAACTCACGTTGATAGATCCCGAACACAAGTCTTGTTCCTCTCCATTTCTCCA
ACACACGACAAGTAACTCAGCCTCTCTTGTTATATTGGATCATATTTTCTGATGTTTTTG
AAATGAATGTCCTGACACCATTTGTATACATTTTGGGATTGATCAGCCCGAGTGACTGGG
CGGCATCATCGTCTTCAGGATCCAAGAACTGCTACGGAGAAACAGAACCGATCACAGGAA
CAGCTTATCCAGTGAGCTCCTACACAGATCAGCTAAGATCAGTGATTGTTGAAGTGCTTC
ACGGGATGCACAATCCGGCGTTTCTTCTCGACATAACACTCCTCTCTTCCCTAAGAAAAG
ACGGTCATCCGTCAGTATACAGCGGCCTCATTAGCGGTTCACAAAGGTCTAGACCAGACC
AGTCTGCAGATTGTAGCCATTGGTGTTTGCCTGGTTTACCTGATACATGGAACCAGTTGT
TGTATACGCTTCTCATCTATTAGCTTCTTTTTAAATCTCTTTCCATCAAATTATTCGGTT
AGTAATATTTTAACACATTCGAAGAGAGAATCTTAAGATTAATCACGGAATCAGTCAATT
GTATAAACTTTTTGAGGAAATTTTCTTTCAAATGAATTATAATTTTTATTCCATGCAAAC
AAAGCATAGTAACAAGAAATTTAACAATGGCAAGCCCAAAACAAACAGTATTGGGCTTTT
AAAAAAATACATTCGATGGGCTTATTGGAAAAAAGCCTTTTAGGGTTTTCTCAAAACCTC
TCTACTATAAATAGAGGAAATCCAACTTTAGAGTTTAAGAAGAAGCAATCCAAAATCAAT
TCACTGAAAAGCTTCGTTTTTAATCCTGTAGTTTTCATAGGGTTTGGTGTTCTCTCTATT
GTTGTTATTGGGCTTGCCTTTTGTCTAGGATTATCATGATTTATGTTTATTGAAAGATTG
GCTTCATCAGATAGTCTATGTGGATTTGTTCGTTCCCATATGATTCGTTCCCTTGAAGCA
AAATCAATCGTGTTGCTTTCGTTATTTATATAATTCTCCCTATGAATCTTCGGTGATTTC
GTATTTATACGATTTTTGCTGATGTTGATTTGGGAGAATCACAACTGAGCAGCTATATAT
TATTCGTATTGAAATCTAGATTTGGGTTTTTGTATAAGTTTTTGGAAGAACAGTGATGAG
TCAGTTTACAGACCTGTAATGATTGCGGTAATGATCGCATTATTATGAACATCTAAGGGA
CTGAGTTCTTCTTTCTAATATGATTTAACAACTTCAATTTGTTTTTGTTGGTTAATGTTT
TTTTGTTTAATCTGATAAAGAGGCTGATGAAGATTAGATATTAATGGTTACTGAAATTTC
AATAAGTGTGTTGATATACTATCTTCTTGACTAGGACTGCTGAGGCTAATCTTTGAATTC
TAAGGAATTATGTTTTCTCTTTTTGATTTAATGAAATTAGATTGTGGATGATGAGAACAA
ATATGAAAAAACAGTTATCCCTGTCTGAGGATTTTAATCCCTTTGATGATTCATTTGTAA
TCTGACACAACCTTCCAGTTCATATCGTTTTGGGTTTTGCTTGTTGACTATTTATTTCAG
ACCCTAAATTATACAAACACGAAGATTTGTCATTGAAACAACGCAGCTTCATTCAAAAAC
GGATTTTAAAATTGGAAATCAGACAAATGACTAAGCGGGTCCCTTTTGACTTTAGCATCA
ATATTCAATATTACCGTGCCAGTAATAAGAGTTCTCGAGTCCATGAAATGATGTTGTATC
AGTTTTCGTTCAGCATTTCAATAAATTCACGATGTTTTGGTCAAAATATCTTACTACCTA
TCGACTGTTATCGGACTTCAGGTTCTACTCTTTGAGTCGTCGACAATGAAAACGTTTCTT
TTTCCTACTGTAACGAGAAGGCAAACAAGTGGTATTTTGTTACGATAAAAAACAGGTCAA
AAAAAAAATTTGTTAATTGAATGTTTAACACGTTTCCAAAATTTATAAATGTTCATATTC
AGCTTACATTGTACTAGCATCGGCAGTAGTTGATTGAATACTAGTGTCGAGTGACATCAG
CTTGATATCAAAGCATGATTGATTACATTATATAATATCCATTTGTAAATAATCCACCTC
TCAAAAAAAAAAAAATTAATAAATAAATAATCCACCTCCGTTCATATATAAAGATTGTCA
CGGTGGTCTACCTTAACACTACAAAGGCAGTCCACGACTGAGAAAAAAAAAGCAGTTCAA
ATTTTTTTCGTATGTGTTAAGGATGGAGTACATTCATAGAGCATCATCTACATTCTACTC
CAAGATAAATGTGGAGTATCTGTATTACTTTTAGTTTTGTAAAGAGATTATACATAATTT
AAATATGGTACATTACTCATTACAGGTCTTTGAGCTGTGGCGTTCCTTAGCCATGATGTT
TCATCCTCTATATTGTCGATACGAGTTCACACTTTCTAGCTTCATCTACATACCAAAATC
ATGAATTGTCGTATAGGGCCTTAATGGGCTTAAATGACCGAGATAATGACCTGTTAG
  Untranslated Region
  Coding Sequence
  snoRNA
CP002688 NC_003076
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved