Arabidopsis_thaliana Locus poly:SnoR88-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR88-2
Arabidopsis_thaliana
poly:SnoR88-2
3
SnoR88-2, SnoR19-2, SnoR64, SnoR20-1, SnoR38Y-1
1001..1131, 1184..1261, 1501..1573, 1612..1688, 1765..1849
2849
ACAATGTAATATTTTTTTAATTATATAATTCCAATCTTCGGTAATTGACAGCCAGATAA
TGACATTGACATTTTCTCATGGTAAACTTTTAAACATTTTCACGGTGAAACAAAATAATT
AAATAGCAAAGTGTTATGGTTAAAACATTTTTGCAGCTAGATAACAAATAAACTGGAACT
GATTTGCCACTTAAACATTAGTGGTATATAAACGTTAGAAATTCTTGCACGGTTGATATG
AAAATGGCTTTGGGTTCTCATACACAATTCTTGTTATTTTATTTAGTAATGTGTTATCAT
GTAAAATAGTGTGTCATCATGTAAAAACAACAGTCTATAAAGCATGTTATCATATAAAAA
GTAACATAATATATATCATGTAACATTAGTAATGTGTCATCGGATAAATGAACATGTTAT
TTATTTTCAAATTAAACAAATATAAAATCGTTAATTCTTTTGGGTTAAAATCTTAAACTC
ACCTCAAAAATATTTAGCAAATTAAAAAAAAAAAAACCAATAAATCATGTCTCATATTAC
TTCCTAAAATTTGGCTATCTTTTGTTGATGTTTTTGGTCTGACCTAAAAAAAGGTTTGGC
TATCTAAATCTACCTAAAAACACACACTAATACAATTCGATACTGGGCTTCAAATAAAAA
CAAACTCCTTCATTATTGGGCCACCATAATGATCGACCTCACAATATCTCAGCCCAAGGT
TACTTTCGTCATTTAAACTCTCCTACACTTAAAAACCCTAATCTCTCTACCGTCAATAAA
CCTCCCTATATAAACACTTCCACACACAAACCATTCCTCTCACACAAAATTCTTCAGCCG
ATTCATTCTCTAGGGTTCATAGCTTAGTCCTCGAATCCATATATCTCTGCTGCTGTGTTC
TTCAATTGCTTTAGTATTAGCTTGTTCTTAGTGTTCATAGAATTTAGGGTTATTAGAATG
GCTTCATCAGATAGTCGATGTGGATTTGTCCGTTCCCATATGATTCGTTCCCTTGAAGCA
ATATTAATCGTGTTGCTCTCGTTCTCTAAATTGCTCTCTAATCATCAAAGTAATCATACG
GTTAATTCTAGTATGATACCGATTAGTGAGCATAACTTGAGCAGCTACATAATCTTCTCT
TACGAGGGTTTTGTTTTGTCTTAATTCTTGTTTTGTTGTGGAAGAACAGTGATGAGTCAG
TTTACAGACCTGTAATGATTGCGGTAATGATCGCATTATTATGAACATCTAAGGGACTGA
GTTCTTCTATCCATTGTGTTTTAGTTTTCTTTTTGTCTTGGTGGCTTTTACATGATAGAA
AGATTCAGGCTTTGAATATATTTTAGATGTGAAGCTTGTTGTGAAGTGTAATTGCCTACA
TTGAATTTAGTTTCCCTCGCTATCCTGTTCTTCAATTTTCAATGATGTTTCTTAGGACGT
CGGGGAACAATATGTTTTATATTGATGTTTTGTTATTTTGCAATGGGATTTCAAATGAGG
AATACTTTGCCAAGTTGTTGAATGCTCAGATTTTTCTGGGTTTTATGATTCACTTGTATA
GGAAGATCTGATGATTTCCTTTTGCATTGTGTTTTTGTTTTTTGTTTGGGAAGCCAGTGA
TGATTAGATTCAATGGTTGCTGAACATTCAATGTTGAAAAGCATCTAACTTGACTAGGAC
GGTCTGAGGCTTTTAATGAACTTTTTGTTTGCTCTATCGTTAGTTTTGTGTCCATGATTC
AGGATTGTTAATGTTTTGTGATGTTTTGGATGATGAGAAACAAAAATCAAAATACAGTTA
TCCCTGGCTTAGGGTTTAAAGCCCGTTGCTGAGTCTTTTGTAATCTGACACACATCACAA
CAATTTCTCTTTACGTTCTTTTGGTACGATGCTTTTGTGTTTTCAGTTTATCTTAACTTT
GTTTTATTTCTCAATTTTACGATTCATGGTTCTGTAAATCCATATTGGGCAGTCTTTTCA
TAAACAAAACGAGGTGTGATGCTAAATTTCATTGGGACAACGCTATATTGTAGAAGACGG
TGAAGATTGTTATACGTTTTGCAAGGCAGGGATTTATGATGACACTCTCCGGTCGTTTTG
CTTCCTTGATGCAATTGTTTTTCCAATTTAGGTTTTGAATTATTACTCACTATTTTATCA
GGGTAGCAACATTACCTGAAAGTGTCTCTGAGCTATCACAAAGATTGAAAGAAGTTTATG
TGATCAAAACTTTCCTTTTAACTTTATTGTTTTCAGTATTAGCTATCTTATGTTATGTAT
ATCAATGAATGTTTTTAACGATTAAGCACACCCTTTAATACAGTCTTGTTTAAGAATATT
ATGGATCAAGATCAAAAATTTAGCTGTACGTTCAGGTAATGAATGCGATGTTCTGAATGA
GAAATGAAACTAAAATCATGCATTTAGATAACTTTCACATCACTTGATAGAGAGGGACGA
TATTTTTGCAGGATTTAACTTCGTAATTATGGCTAACAAAGCTACCGTCTTTACATTATT
TGCTCGGGGATAACTGAAATACCTCCCTTTCTAGCTTTAAATGTCACTTAAATAGCCTTC
GCTTGTAAAATAAAAGTTTGAATATTTAAACCAGAAAGCTAAGTAGAGAGGTTGTGATGG
GTCTGCAAACATGGATATGCTTCACACTATTCTCAATTTTCTTCTTCCTCCTCTTACTAT
CAGTTTTCTCGTCCTATTTTACCCATTTTATCTTTTTACCAAACTTATGAGTTGTCTTAA
GCACCTTCACTTTGAAAACGTTACTGGGAAAGTAGTTCTAATCACCGGAGCTTCCTCCGG
CATCGGAGAGGTTAGCTAGTATTGGATGTT
  Untranslated Region
  Coding Sequence
  snoRNA
CP002686
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved