Arabidopsis_thaliana Locus poly:SnoR32-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR32-2
Arabidopsis_thaliana
poly:SnoR32-2
SnoR32-2, U80-2
1001..1103, 1275..1356
2356
gtcatcataattttttctttttgtgtgtgtgcacatgaagtcgtttgctccgataagaa
aaaaattgagtagcaaagatacgattttcttttaatttttggaaaaatccaaaaacaaat
ccaaaataattttaattggacgattattatccgttatttttatattagaataaaaatacc
ccaactaattatttgtgattttaaaatacttcataaattaataatttgtggaattaaact
cgtaattatttatatacaaaatatattaaaattactaataattagatgaggtatttttat
tttaatacaaaaatatcagataataatcgtctaaagataaatctcacttttttctcttta
ttatttaatattctgatctttgcggatgtaatattttctttattatttatagtatttata
tccaccataaaataaaacatttatttataacactttggacttttttttgttgaaattttc
gttttttttttcgtttttttatcatagaattgataaataaaaatagaaatgtaactttgg
aaaatagagtttgcattaagagtttgtataactaattttgactactcaaaaccatattta
cttaaaagattatgattttaaattttgtgaatccaaagtttcggccggttttaacggttt
aacccaaatccagtttttaacttaaatccaaactcggctacatgaacgatttctaatttg
atagtaagccctggtaaagcccaaactatgataagcccaacaacgtccgtagcggtgtgt
gatgttgagcaccgtcagatgtaacagtggacacgtgtcagaatcttaacgagtgagaaa
accctagcgctccatatttattttctgtataaaaacccaaagagagagagaagcttatca
tctctcaagctacaaattgctctcgtaatcaaatccttatactttctccaacccttactt
ttgttattgtcgtattacaaaattgtttttttttttcttccggacagtgacgattgatat
ttaaggtctcgttcgtcgtaaaaacggccgtaaaaagcctatttgccgaccattctgtta
tatcaccacccatattctgagtcctactttttgacttttgtttttcaatctttcttctaa
tcgatttttttggccaatgatttaatcaaaaaaatagacaagcatatgtctgaattaatc
cttgttgataaaatctaatcttctctatgaggccaaacaatctttggtttgtttttgttt
atttggaaaaaagggtcaagtgatgattaataatgcatagttcaaatgatctccatgatt
actattcagtagcacagtctttcgctcctatctgatggccctccactttttttattgatg
caatgttattggagctgtgtttttttaactccgcttaatgggcctttaaaggcccaacta
gtgaaaactagaaaatactacaatctgataaaagtttattacaatctattttttcattgt
tttcaacaacgacacattctacaactataagaagtgtttacatgaacaaatcggttctgt
tatatatatgttttttatacataacatgtacgtttacaattttcttaaaacacatccgag
gaagatgtttgttatgtgcctggaaaagagctaggtgttgtgctttgtaagatgatgaaa
gcgcaaacaacagaaagagagaaaacagagacccaagtattctctgtatacatctccatc
gcgtctgttaacgacaacctcgtcctgttctctgcccagttccttagtctatctgcttct
gctgcatataacgcccgtccctgcaaacacgtacacatctttgcgtcagctcaggcttaa
ccaagtgaaggatttgtcaaaaaacttgaactagaactcaagtgtaacacttacttggtc
atcaaaccatcggcctctccttagccaggaagtgacaatagctaacaatatccgaggagg
agttaggtaattgacggcttttcccgaacctttcacaactcgcattcgtggtaccaaagt
tctagctactgtctcaggaagctcacagattatgttaaacatctgcttgtttttaatgct
cgaaccactgccaaataaatggttgcttcaataaaactccggagcattctgttctaggcc
ttagtgacaaagtgtatgcatacctgagaagaagttctgtcagaaccatgccaggggatg
cagtgtgaaggccaacgtttgttttttggctttctttcactatagacccatgaaactgcc
taagtccacattttgttgaaccatatctgcgaaagctcacagactcagaaatgtgttcta
attcattagagactagt
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003075.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved