Arabidopsis_thaliana Locus poly:SnoR32-1
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR32-1
Arabidopsis_thaliana
poly:SnoR32-1
SnoR32-1, U27-1, U80-1
1001..1102, 1183..1337, 1453..1539
2539
tcacaccctcttccttcctcggatagagaagtctttagcttaaggagtttttaactctt
aacaagaagataactatctcaaatgtacatgttataatctttaaatgttctctttgtttt
tcttgactttcaaaaatagaggatatttaatacgtttaactatgtgtatcaaattatcaa
acaatatgcgtatggtccaaactccaaaggtgcatttgaaatatatcaaacatatctaaa
aacgtaaaacaaattgaccacttaatcttggatataaagttaatcgtacgttttacaatc
ttcaatatttcaaatctgatattacttttaaaaattcatgtgtgtggagtatatttgcag
tatactttaaactttgtttctaataatttgttcatgaaattcttttgaaatttatttaaa
aagacttagtatacaaatatttctaagatatgtaattttgagtaacctttgtttttttta
agaaattaatcttaatttaataataccaaattgtaaaatctcctttaatcatgatttaca
aaaagatcaaataacacaagattttaagacataatttaattcgaaaaaggccacgtaggc
tagtgaatagttatgatccacattgcgtgttagttcaatggacccatgacaggcctttgg
gccagggaaataaaagtcggttttctacaagaaacagtatgtagtttaaaagtatctata
tgaaactgcacgtcgtttttcacaggaaaaaacggaagatttaacatatcacaaccgtca
gacgtaccacgtgtcaacatcttagctaagcttgtcaaagaatccaaaaccctagctctc
aatttttgttttgtttctctgtataaaaggcgtgagaaagtaatcacacattcattatca
acttctctagggttctttagatctccgccgattagcttctctgtttttcatttttcatct
tcttcttctggtttaaaacttttgtttttggtaaaagtaatggacagtgacgattgatat
taaggtctcgttcgtcgtaaaaacggccgtaaaaagcctatttgccgaccattctgttat
atcaccacccatattctgagtcctattgatttttgtttttcaatctttttctaatcgatt
ttttggccaatgatttaatcaaaattgacaagcatatgtctgaattaatccttgttgata
aactctaatcttctctatgaggccttttttcaattacctttcaaatccgatttcgtattt
atttctttggttctgtttttggttgatttagtggcctatgatttaaatgattatagacaa
gcatatgtctgaattaatccttgttgataaatctaatcttctctatgaggtctaaatccg
attttgttttttggttattggttttaaaattgtcttggatttatttgatgagaaaagagg
aaattgaaagggatcaagtgatgattgataacgcatagttcagatgataaattctattat
gattaacatcttcagcatagtctttcgctcctatctgatgaccctttcctctctattttc
atctattatccaaatttttcaatctcaaattgttccttaagtaactattttcttttccta
aaattttgttgtaatcgaatggttgggataaatccggataaaaaagtacggactgatcga
ggagaagttgtgatattgaatggttggccagtttttctaaactagatcaacccagaaata
caatttgaatatcggttactaaagtttaattttgttgggacatttgattaatctattaat
tcacaattcaattaatcttgacatattcgagaaagtgacaatatttgtctctaaaactta
tagtgacgtattagagaattttgttagaatacttataactgtgaaaactagttagtcata
gataattttctaggcaattgggtttgttgctactaaactaaattaaagcaaacgcttcag
gaaaacagattggtttctctatgtgaggtgttgataacttgtatcttgtttgccaactag
tgagtcttcccaaacgaggtggtaatggtttgttatgtggcattaatttagttattgttt
agtcactgaaccatacgttttttactttatgggcctattgttgtattcaaaagtcaaaac
ccaaatgggccaaaaaaagaaaaagggactgtagataaattgaaagtataaaagaacata
ctgaaagtatctaaatttttttaaaaccgaaagaattgaaacggaactaaaatcaaatcg
aactttcagaataactaaatagaaattaaacttgaaaaaattgataaccgaaagaataca
accgaaatcgaataaataaccgaaataaaatagatgtaagccataaaaatggggaaaata
aacatttttcttaaaaatgaaacaaaatagatgtaaaaaaataaaggaaaatagaaagtc
aatattattgaggattaatagaaagtcaaccgaactttgagattatggattcggttggag
cggacagatcaggtgatctt
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved