Arabidopsis_thaliana Locus poly:SnoR37-3
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR37-3
Arabidopsis_thaliana
poly:SnoR37-3
SnoR22-2, SnoR23-2, SnoR80
1192..1285, 1384..1441, 1512..1638
2441
TGGCGTCAAGATCTTTACTCACTAACTCCTTCACGATATCTAGCCATTTGTCCGTATAT
TTGCTAGCTAGTAGTCTTGAGACAGTATATTTATTTTATACGTAAACGGATTTACACTTA
GAAAATTCAAGACACATAAGGAAGTAAGAACCAAATCATAAAAAATTGCATGCACTAGCG
GTTTAACAAATTTTAGTATTTTAGTCTTCGAGTTTAAATTGACATATTATGATTTGAACA
TCAAAAAGTTTTCGAAATTCCTTTAACAAAAAAAAGCTTTTTGGAAACACTACAATAGTA
TCTTAAGTGACCAGATTTTTTTGCGGTATTATGATCCCAACAATCTAAAACAAAGCAACC
GCAAGAAACAACTACTCCTTGAGTCCTTCTCTTCTTTGTTGTGGATCCATTTAGTATATT
CGTTGAGTAACCAAACAACAACAAATTTTTTTTTTTTTTTTTTTTTAACATTGATTGTTG
TTTGAAATTTTACGGAATATTGTTTATACACCTAAATATTCATACGGAATTTTACGCAAA
TAAAGCATTAATATTGCTGGCTACTTGTAAGTATCCTTGCCGAGAAAGGTTAGACATATG
TACTATATGGTAACCTTGCATCCACTGTAAAAACTTATTGTAGTCACTTTCATTTTTGGG
TTTTAGACTTTAGACACACAAGTAGTATCGCTACTGAATAATGATAATGAATTTATTGTT
TGGGCCGCGTAATATGGCCCATATAAATTAATTGGACTAAGAAAAACCTAAAAGTAAATG
GCAGCCGCCGGAGGTAACCTTAATTCTCTGAGATGAGTGTCTTTTGTGTATTTATATGGT
TTCGCGTTCTGCAAATCGTAGGAGCTTCTTCTCTATTAATGTCTGAATGATATAATTCGT
GATCTTAGGGTTAGGTCCGTGACTATTTTCGTTTGTGATATTTAGGGTTTTTGTGAGAGA
GATTTGTGATGTCTTAGTTTTATGGGATGTGGAAGGGGTTGAATATGGTGATGATACAAG
AGTATTGTGGACTAGAGTTTCAGATCTGGGATTCTTCTCCCAGAAGTTGAAGATTAACCC
TTGGCTGTCTGAGTATTAATTCCCCTTTCACTCAATATCTTATCTTTTGATTGATTTGAA
GATAAATTTCTCTGTTATTGTTTTTTTTGTTGGTTGATGTTTTTTTTTACTTATGAGCTG
ATGATGAAAAAAAACAATTATCTTAGCGGATTTCAGTGAGGTTTTTGAATCAATGAACTG
AATTTGTTACACACACTGAAGCTTATTTGTTCTTTCAATGTTTTTTGTTTTGTTTTGTTG
GATTACTGTTATGGGTTTGATGATGATGATGCAATGATGAGATAAAAGCACGAAGAGTGT
GAGAAGAGCAGTGGGTTTACCGTGAGCTCTCCTTTAAAACGACTTCTCCTTCCACTGAGC
ATTTTTTATCAAAAATTTTGCCCTATTGAAGAAAGAGTTTTAGTGTTTTTTGTTTTTGTA
TTGGCGTCCATTACCAATTCTGAGGGATAAAAACAGTTCCTTCAGGTATAATGGCTTGTG
ACGCTATATTGGTTGTGGTATATCCTGATCTTTTTGCTTTTTTCCATGCCTTTTGATCCT
GGAAATGCCTCGCACATTATATCAATTGGTTTTACTTTTATCTGATGCTGGTAATTACTT
TATTCTAATGACAACCAACTATGCTACATACATGCATCTCTTTCTGTCAAAATTGTTACA
TTGTTCATTTATATTATATGATAGTGTTATCTCGGTGGGCAGAGGGAAGTTGGTTGCGTT
AGCTTCTCTAGTATATCCGTTTCACAGTTTTTCCTCTGTTGAATTCTTGCACTAGCTTTC
ATATGGGCCATATTAAGTTACATGTGGGTGGGTGCCGTAACAGTGCAGCAACCATTCTGC
TAGCTTGTGCAAGAGTTTAAAAGTGGTGAAACTTTTATTTGGATAATCGAATTGGTTGAG
GAGTCTAACAAGTGATAGTAGCTAAAGAGGCTAGAGGGACGCTAGAAAAAGAACAAACCA
TGAGCGTATGAAATTACTTTAAAACAATACCCCATGCCCCATGAACTATTATTCTTCTTC
CTCTCTTGTAGATGAGGCATTCGGTATCTTCCTCTACTTTATCTTCTTCAGTGTCCTTCA
CTACTACAACTTCTCCAAGCTTCCTTCCAAATTATGCTATCTATTTCACATTACGGGGCT
TCCGATTCAACTAATTTTAAACACAGAATCCAAAGCCTGCTTGACAACAAAATGCACATC
TAGAGGAAATCAGATTCACCAAATTCTAAAAATTAGAAATCTCAACTTGCCTTTATTTTA
AGCTTCTCACATCCCACCATTTTCATCCAAAGCCTGCTAGACAACCAAATGCACATCTAA
TCAGAGATAAAGGAAAACTTGAGGGATACGTATATTTGGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved