Arabidopsis_thaliana Locus poly:SnoR37-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR37-2
Arabidopsis_thaliana
poly:SnoR37-2
4
SnoR37-2, SnoR22-3a, SnoR22-3b, SnoR23-3, SnoR80-2
1001..1096, 1183..1282, 1371..1459, 1524..1617, 1688..1814
4128
ccaaaatacctttcatcttccggaaagacctaccttgagctgcaaaaaaaggtaaccaa
tcttttgaactaaggatatgaggaaggcacttcactggataaggacgagtcaaacaagga
aactccaattcgttgactgactcatccaaatcgctgacgtcatactttttgtcgtcgtac
atttcttgaacgtgaagtgtgattcccaaaaacgtagcgtttgatgtgtagatcatataa
caaggaactccaaattcgttagctatatcgatcattgaagaacagaacatgtccaccacg
aatccggcgagttttcttgttggattgatgattctggagacggtgtctctcacttgtggt
ttttgtttctcgatgtagacttgagacggctcaagatttgcggttggtggttgtttttcg
acggagatgggttcgtagcggaggcgatcttgagactctgcaacgagggatgcgatatag
gcggttgcatcaccggcgtcgtttctagaagggatgatgattacggtgattgaaaaaatg
ttcttcgcttccgatgagttgctttgctagcttcacggttggccggagatggccgattcc
cggcgaaggtatgaacacgagctcaatcttcttcatttctgtttttacgtttttggactt
ttcgttgattgggtttgtaaagtgaatgtgttaataaagtaaaataaatgtaagttgttt
gttgggtcacgaaagctggcccatttagtataattgggccgagaacctaaaatagatatg
gtagccgccgaccgaagtaaaccctaattgtctgctgtgtctgtgtatttataaggtttc
gtctaatgcaaatcataggaactctctttcttttcatgtctgaatgatatgttaggtgat
tttagggttaggtctgtgactattttcgtttgtgtatatatgttgaaattggtgatattt
aaggtttttgtgaaagagatttgtgatgtcttagttttatgggatgtggaaggggttgaa
tatggtgatgatacaagagtattgtggactagagtttcagatctgggattcttctcccag
aagttgaagattaacccttggctgtctgagtattaattcccctttcacccaaaatcttat
cttttgattggtttgaagacaaatttctctgttattgtttttttttgttggttgatgttt
ttccacttataagcttatgatgatagaaaacaattatcttagcggatttcagtgaggttt
ttcaatcaatgatctgaatttgttacacacactgaggcttttttttttttttaatgtttg
gcttttgtttagttggattattgttaataggtttgattgatgtttgtatgtacttgtttt
gggttataaagctgatgatgataaaaacaattatcttagcggatttcagtgaggtttttg
aatcaatgaactgaatttgttacacacactgaagcttatttgttctttcaatgttttttg
ttttgttttgttggattactgttatgggtttgatgatgatgatgcaatgatgagatgaaa
gcacgaagagtgtgagaagagcagtgggtttaccgtgagctctcctttaaaacgacttct
ccttccactgagcattttttatcaaaaattttgccctattgaagaaagagttttagtgtt
ttttgtttttgtattggcgtccattaccaattctgaaggataaaaacagttccttcaggt
ataatggcttgtgacgctatattggttgtggtatatcctgatctttttgcttttttccat
gccttttgatcctggaaatgcctcgcacattatatcaattggttttgtttttcctctttt
ttaataccggaagagattagctagttattctttgattttcagttggtggaagggctttat
gaaaacaattggtgtgtttaaatgttatgttttcttcactacttttgcaaaataagtggt
taacaaaacaattgaaaactatgagctgatttttggacgaataatggatttagcgttcct
atagaattgattaacaaaacaattgacttatcaggaaacaattgtttggtcgaatgagct
gctttttggacatctaatgaaatcttttggcaaacaaacaatgacaaccagactggtcat
gccatgagcgaccttttcagctaatgccagcagttactgtctgttgaattgtttacaagt
acatttagccttttttggcatggaatgcattgggagatgtttcaaaaatagtacatttag
cctttttactgaggctggtaaaaaatcgtaaacgaatatcaatcgttgtcacaaagtttt
ctctcttaaaacatgatcgctcactagaatttcaatcatttaagtgcttctaacatctca
tattttaagttgtgaaaacacacttagtaaaattagtgagaaatagatacaataactatc
cataaccacaggttaatgaaaccggactagtatgctgcaaactcctagatccattaaacc
aacactcggaataaattgcttcgaactagtcttattactcggatgttttgaataacaaga
aaaacgtgttcaaaattaatgacatttacacgtttttttattaacaattctcgaaattct
tgcgagccacagaaagtacctaaagaatcaaacaaaaactccgaattgtatggtcaacca
cattatgacatcaacaaaatctaaggaacaataaaaccacacgtgacaaaagataccccg
cgtggcaaacccgcttaacaaggtggaccccacacaggataaaaacagagcaaaaccttt
tcttctctgttctttctcatctccttctcactggactctcacacacccttgtaaagcttc
taatctctggaaccctgaaacataaacaattttacacgattattgttatactcttgttta
gaaaaaactctgtaattaactggttatgagtttctagacattgtgattttagtactgatt
cggtctcgagaatccacattttcttagtttgtgagtgtttctctaacattcaaacacaac
catgtattagtcacagtcacagtcacacattaaaaagatacatgaacctataatgaatcg
taattttgtttgatctctgaatgttctgtttttgtctcacgatccttctatgctatagga
ttttaggtgtgtgtagcgattgggattgagaaatcgttatttctttggagttttgtcttc
gaagaagtatggaggctcgatgtgacttttgtggaaccgaaaaagcattaatctactgca
aatctgattcggctaaactttgtttaaactgtgacgttaatgtacactcagcgaatcctc
tgtctcaaagacacacgcgatctctactctgcgagaaatgttccttacaacccacggcag
tacactgtatgaacgaaaatgtttctctttgccaaggatgtcagtggaccgctagtaact
gcactggtttaggacacagacttcagagtctgaacccttactctgattgtccttctccat
cagatttcggcaagatctggtcttcaactttagaaccttctgtcacaagtttggtctctc
cattttctgataccctgctccaggaattagacgattggaatggttcatcaacttccgtgg
ttacacaaactcagaaccttaaagactattcttctttctttcctatggaatctaatcttc
caaaagtgatagaagaggtgacgtgttgtttaagtaatatatcaaaatgtttcatttatg
ataaagaagaatgtttttcatttatattccgttctatatgcaggaatgttctggtttgga
tctatgcgaagggataaacttagatgatgcgccgttgaatttcaacgcaagcaatgatat
aatcggatgttcatcacttgacaataccaaatgttacgagtacgaggattcttttaagga
agagaataacattggccttccttcattactgcttcctactttatccgggaacgttgtacc
gaacatgtcactttcgatgtctaacctcacaggagaaagcaatgcgactgattaccaaga
ttgcggaatttcaccagggtttctcataggagattcgccatgggaatcg
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003075
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved