Arabidopsis_thaliana Locus Poly:SnoR37-1
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR37-1
Arabidopsis_thaliana
Poly:SnoR37-1
SnoR37-1, SnoR23-1, SnoR80-3
1001..1065, 1286..1396, 1463..1590
2590
GCGAGCCTCGGCGAGTCCGGCCGCCTTGAGTAGTCATCAACGAGTTTTGCAACGGTACG
TTTCACCATCGGGATGTGGTTATCGACATGTAACCCGACGGTTGGTTGATCTCCGTCCGA
GATCACTTCATAGTGAAGGCGGTCGTTGGATGCGGCGGAAAGAGCTGAGATATAAGCGGA
AGCACTGACGTCGTCTCCGGAAAGAAGAGGAAGGATGATAATGGAGATAGAGAGGCGAGT
TTCTTGCTCCACTAGTAGCTTAGCCATCTCGGCGGTTGATTTGAGATGACCAAGTATAGG
AAATGGTACGAAGACAAGCGCAAATTTGTTCATGTTTCTCTCTTCTTCTTTTTTTTTGGA
TGCTTTGTTTCGATAGCTTTGTTTATAGGAGGAATAACAAGAAAAGAAAAAAAAATCCCC
CTTAAATCGATATCGTTTATAAAAAAAATCTGCCTAGTTTTCCTCCAATTAGTTAGTTAT
AAAAATGTTTCATACTATGAGTCACGAAAATCTATTATTTTCTGATTTTCTCATGATGAA
AGGGTACGTACACACGTGAAACATGCAAAGTAGTATGTAGCAGAATCCTAGTCACAGATA
ACGTTCAAGACCGTTGCATTGATTGCGCTAGTTTCCTAGATATCGTCATGCGTGCGATCA
ATGCGAGACCGAGAGAAAGCCGCTTCACCACACAAAGACGAGTCAAAAAAAAATTAAAAT
TAAAACTCATTGTGGGCTTTTAATAGGGACTTATAAAACAGGCCATTTTGTACTTATTGG
GCTTTCTTCAAAACAAAACCCTAAACCCAAAAAGAAAAAATAGACGGTGTAGCCGCTGAA
AAAACCCTAATTCCCAAAGCTAATCCGCCGGCGTTTATTTGAGTATATATACGTTTCGTC
TTCTTTCCTCTATTCAGAACAACATATGCTTCTTTCTGCTTAATAATTTCAATGAGTCTA
GGGTTTTGTTATCAAAGTTTTCGTTTTTTTCTGGGGCGTAGAAAGGGTTTATGGTGATGA
AACGAATATTTCGTGGACTAGAGTTTCAGATCTGGGCTCTTCACCCAGAATTTGAAGAAA
CAACCCTTGGCTGTCTGAGTAAATCCTTTTTCGCCCACTATAATGAAAGTTTTTGTTTTG
GTGTTCCCTTTGAATTGCCTATGATGATAAAAACAATTATCTTAGCGGATTTCAGTGAGG
TTTTTTTAAAATCAATGATCTGAATTGTTACACACACTGAGGCTTTATTAGTTTGATTTG
TTTTTGTTTATTGGGGAAATTTGGTTTGCGATGATGATAAAATAGCACGAAGGTGCGTGA
AGGGCAGTGGACAAAGCAATGAAAATTTGTTTTGCCGTGAGCTCTCTTTAATAAACGACT
TCTCCTTCCACTGAGCATTTTTTAGATCTTCCCTAAATCTTTGTGTTTGTTATTATTGTT
GTTAATAATGAATGGCGTCTTTTACCAATTCTGAAGGATTAAATATGGTTCCTTTAGGTA
TAATGGCATTGACGCAATATTGATTGTGGTATATCCTGATCATTTGGCTTTTTTTTCTAT
GTTATTTGATCCTGGAAATGCCTCACACATTTGTTCTATCTTCTTTTTCATTATTTACGA
ATTGGGTTTCCTCTGAATTTACGATGAGGTTTGTTGGTTGAATATAAAGTTGTTGGAGCG
AGATGGATTGTTTGGAGTGCAATGATGTTTTCTTTTCTCAGATTTGGTTTTTCTAACTGA
AATTGATGATTGTTCTGTTTTATTATTCGATTAAGACCGTCTCCAATATTAATCCCTATT
TTTTCGTTGGAGATGCTCTTGCTTCTTCCTGTTTTAGTTGTCAAAAGTCTTATGATTGTT
AATCATTTGATTAAAGACATTCGCATACAATTCTGTTATCAATAATGAGAAGGAAAATGT
GATGATTTAACATACGGAACAATTATGGTTGCTGTCATTACTTATACGAGTTCGATGTTG
AGAATTGTTGGTGGATAATTTGTGTTGCCTTCTTGATTTCCTGCGTTGAAACAAAAAGGT
TGCCACATTTTGCTGGATGAAGAATTGTTGGTTCTGTGTGATGTTGTTTATGTGATCTTC
AGGTGTGATCTTACATGAGAGACTAAAAAGAGAGCAACGGGTTTGGTTTGAGTTTGTTTA
GGTCAAACCATCAGAGAGACATTACGAGATATCGTATCATACCCTTGGGCCAATTCTGCA
ATATGCGTTGGAGTTTTGTTAATCTTGATCATACCTTTCATATGCCTATTATCGGCTTTA
TTGACTTAGTTGTATCACTTGGTCCTATACTCCTTGTTCCCTTTCTCTGATAAGTCTATG
ACTTCGCTGTTATGATCATTGCGTTTGGTTTTTGTCGTCCCTGTTTGTAAATTTGCCAAG
ATTGAAAATGTAATTTCGAAGAACCAAAATTGTATCACAAGGCAAATATTTTATATACTT
CTAACTCTCCCAAAATATCGAGCATTATCTTAATATCTTTACTATGTCAACTTTTGGCAA
AACTTTATTAGAAATCTGAAAATAAAACTCACAAGATTAATTATTTTTCAGAAAAGAGAA
ACTAATATATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved