Arabidopsis_thaliana Locus AT3G14470
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana AT3G14470
Arabidopsis_thaliana
AT3G14470
U53
1239..1359
5308
TGAACATCTTTTTCGCCGCCCATGATGCAGCTTAAGATGATAAACACCACAAAAAGAAC
GGCGAAGGCTACGAGTGCAATAACCAAATCCGACATTTTCTTAGTTTCTTACCAATTTAC
TTGAATCAAACTATTGACGCCAACTCCATCCTTACATACCAAAACGAGTATCTTAACAAG
AAAGTATTATTATTTTAAAATATTTCAAAGAAATAATTAAATTGTAATTTTAAAATCAAA
ACTAAATTATTTTAATTTTAGAAGATGACATGTGGGAGTTTCATGAAAATCAAAATTAGA
ACAGTTCCTTCCTTTGTTCTATTTCCTCAAAAATAATACAGAAAGCTTATCAAAGTTATT
TCTTTTTTTTTAACATTAAAACCAAAAAAAAAAAGTTATTGATATGTGTAGATTTACTGA
CTTAAAAAGTTGAGATTTTTAAAAAATAGTGGATTTAGCAAAAATATGTTTATCAATATT
TACAAACAAAAAAGAAAATCAAAGATTTTCATAGATTTGTCATTGACTGCCTTGTATTGA
GTTTTTTTTTTCTCTAAAACTTTCTTTATAAGGTAATATGTGTTTATGCTTTTTTTAGGA
ATTTTATAAATATTATCTCATCCAATTTGGGTATGTTTTTTTTGGGGTTAAAATTTCAAT
TTTGGTGTGATTATAAGAAATATTCTCTTCTTAAGTGAAGCATATGATATATCAACCAAT
TGTTTCATTGACATCATTGCTCTTTATTTAGTTTTATCGGCATACTAAAAATATGGGTTT
TTAAGGTTTTGGCATTTTATCAAAATTGTTTTTTGTTGATTGCCTTTACTAATTAGAGAG
AGTCCACCAATCGGAGAGCCCGAAAAATGAGAAAAAGATGTTTGCTTGGCTATGAATAAG
GCTACACCCATTTGGGCCGTTTTAGATCAATCTTTTGTTTATTACAAATTGCACCCTGAT
ATTTTCTATATTTGATGAGAATGAGCAAAGCTTTATATTTTAGTTGGAAAATCCCTGTTA
CTGAGGAAAAGATTACTGACAAAACTTAGAAAAGTTGTACACATATATCACACAACGGGA
AAGAAAAAGCTACATAGAAATGGAACAAAGAAAAACGTATTTGATTGATGCGACCGAATC
AGGTTTAGTCATATCTTGAAGATGAACGTGAATCATATGATCTGTGTGAACCATGAGACT
TCGGTGAGCCTGACACGTTTGATCTTGGAAGATGAAACTGAGGATGATGATATTGAGGCT
GCTGTTCCATTGGCTGTCTGAGATACCTGCAGTTCGTGATCGTGACCTGTAAGTTTTGAG
GCAGAGCGTTTAGTTTCGGAAGAAGCTGCAGGTTCTGACAGTCATTGATTCTCAGGTTCC
TTAGGGCATTCGGACCACGCAAATGCTCATTTGAGAGCTCAAGAGAGTACAAGGATGTGC
ACTGATCGACTTCAAGCTTGTCGAGATTGGCGAAATGGTTTAAAGGAAACTTAACGAGAG
TGTCACAGCTGCTTTTTATGCTTAGCGTTTGAAGGTTCCTGTAACTGTATTCGTGGTGAT
CTGGCTGGAAATCTAAGAGGCCACATTTATAGATGTGAAGTGAGATCAGAGAAGGAAGAA
AGGTAGGTAGAGTCCCGGTTAGCTCTGGACATCTCAGTATGAAAAGTTTCTTGAGAGAAG
GGAACAAGTCTCCTCTTGTGACCCTTACGTCTAACCACTCTTGCCAATCTGGCAGGTTAT
CAAATCGCAGTGTTTCAAGTGATCTAAACGGCTGTTGGTCTTGATCACGCAGTTGTTGAT
CGCTGAAGTAGAACTTGCGACCTATGCTTTGAAGCCCGACCATTCCTGAAATGTGAAGTT
CTTTGAGACATGGTAGTTGACCAAGAGATGGCAAGGAGGTACAGTATTGACATTCTCTGA
GGCGTATACACACAATTCTAGAGAACGAAGGATCACTCAACCAATCTGGAAACCTTCTTC
CTTTGTATCTCTCAATGGCAAGTTTCTCAATATGACGATGTGGGCGTAACTTCTCAAACA
CTTCAGCTTCGTTTTGCGTCCTGTGAGGATTTGTGTTGTTCTCTGAGCTACTAGATCCAG
TTCTCCAGACAAAATCTATCTCCCTCAGATGTTTCTTGCTGTTTAAATTTGCTTCTGCAG
CATCAGCAACATCCACAACTCGTTGTAGCTCAACTATTTTAAGTTTTCCATGAAGGTCAT
GAAGCCCTCCAAGTTCAGAAATCCTTGACCCGTCACTAGCACTCACGAAAAATGTTGTAA
GAGTCTGGAGACTCTTCAATCTACCAAATCTCCGCGGCATTTGTCTTAGCTTCGTCCCAA
TCAGATCAAGATACCGCAAATTGATGAGGTTGCTAATATCTGTAGGCAGCTCCTTCAGAC
TTGAACAGTAGGAGAGAAGAAGTGTCTGGAGGTTGTACATATAACAAAGGGATTTCGGAA
GTTTCTCGAGTTCAGTGCGAGAGAGATCCAAAAACCGAGCATGGCTAATGTTCTTGAAAA
AATCTGGCGGCAGCCTCGCGATCTTGTAATGTGATAAAGACAAAACACGCAAGCGGGTGA
GCGTTGGAAGTAACTTCTCACTGACCATTTGATCTAAGCAGCATGACCGAGAAGAATTTG
TGAGGCTGAGTGGTAGAAAAGTTCTGAGAAACTTGACCTCACGTAGAGCCTCAAACTCCA
TAGGCTCTGCATAATTATCTCGTAGGTACGATAAATATCTGGTCCTTTCTGAAACCTGAA
GTTTGCATCCATCTTCAAACTTCGAGCTGAACTCTCCTGAAGCAAACTGAGCCAGCTCAT
TGATAAAATCATGCATTATATATCTTGTTTTGGTCTTTTGAAGAAGTGACCTTGATTCTA
ATTCAGAAAAGTACTCATTCCCGAGCTCTTCTAGATTCTTACTGCTTCTCGTCTGTTGCA
AGAAACCTTCTGCCATCCACAAAAGAACTACCTTGTCCTTCTCAAATGCATGCCCTTTGG
GAAATATCGAGCAATAGGCAAAACATCGTTTCAAGTGAGCTGGAAGGTAGTAATAGCTTA
CACGTAAAACTGGAAGTAGATTGCTCTTATCAGCTGGAAGATCCCAAATCCGGCTGCTTA
GAACTCTCTCCCATTCTATGACTTTTCCTTCAAACCGTAGAACGCCACCAAGTGTTTTCA
CAGCCAAAGGCAGACCGCGGCATTTGTGCACTATCCTTTCAGCAAGATCTCCAATTTCTC
GATTTAGGCACGGTTCTTGATTACCAAATACAGTTTTCATAAACAACGACCAGCAATCTC
CATCAGATAATGGCTGAAGGTTGTGTACATGGACGGCACACATTATGGATGCAACACGTT
GGCTTCGTGTTGTCACAAGAATCTGGCTCCCTTGAGCAGCATGTATAAAAGGTTGGCGTA
GAAGATCCCAATCCGCAAAATTTTCATTCCACAGATCATCTAGAACAAGCAGAAACGGTA
AGCCTGTTCCTGTTAATCTCTCCTTCAATTTGACTTGAAGTACATCCAGGTCAGTGAATT
CACAAGGCCGGGAAGTAACAGATTCATAAACCTTTTTGGTGATCTTAAAAACGTCAAACT
CCTCTGAGACATGAGCCCAGACTTTTGTTCCAAAATAACTCCGAACATGTTGATCATTGT
AAAGGAGTTGTGAAAGTGTGGTTTTTCCAACCCCTCCAATTCCAACAATAGCTACAACGG
TAATACCGTTGTCTTTCCCATTCTCTGGAATCAAGAATCTCATTATCTCATCTTTATCAT
CGTCTCTACCAAACACTTCAGATTCATCCACAAGAGATGTTGTTGGCAACCTTTGTTTGG
GTATCATTGCAGTAAGCTCTTTCAAACCCAGGATATTTCTTTGTGAGGCTAAACGCTCGA
GCCTAATTGTGACCTTCTCAAGCCGGGTCTCCAAATGTTCACTGTTCCCATCAAGAAAAT
CTCCCAGGGACATTCTGCCACGAAGCTGTCTCAGCCTGTTGGAGGAAGAAGATTCAGCTC
CTATGTTGAGACGCAGAGCTTCTGTAGCAATATCATCAAGAGCATCTTCAGCATGGTAAA
CAACATCTCTCAGCTCGTTAACCCATTTTTCCACCACCGGATTTGTAATCTGCTTCTCCT
CTGCATCTATCAGAACAGCAGTTATTGTCAACAACGCAGTGCTGAGCCTCTCGAGTAAAT
TCTCATTCAGTTCTCGCCTCTTGAAGAAGCTCCTGAAAGGTTCAGACACCAGCGTCTGGA
AGAGAGCTTGTAAAAAAGCTGCAAGGAACATCTCTCCTATGCCGGTCATGTCGTCTGTCT
TTCCACACACAAAGCCTTCTGGAAAAACAAAACAAGCAAGAGACAAAGACAAAATCAAGA
ACAACTTCACAGCAGGCTATCTATTTCTTCAGTGTTATCATCCTCAAATAATTTGATCCA
CAGGGCTCAATTCGCCAAAGCAATACACTCGTATAATCAAACATTCCAATAACTAAGAAA
TTACAAAGCAAGTGGTCAAAACAGTTTGGTCGGAAAAGTTCAGAGAAACTAACCTTACTT
AAGGGAATGAAGTTCTTTTACTACGTTGACTTGACAAAACACACCATGAACCATGCCACC
GAAATGTATTCCACAATCACCAACTGAAACTACTCCGAAAATGATTGGAAGTTGCCTGCA
TTTTCCATGGAGAAAACTTGATGATATCTTGTAAAGGACGAAACTTATGAATTAGTCATA
ATCATTTACTTGGATTAAAACTACCAGAGGAATGTTCAATTTGACTTGAAAAAAATATAG
TCTGAAAATTCTGATTAGGTACAGATGGAAGATTAAATAATATGCAAAAGACGACTTCAA
ATTAACAAAGGTTCATCTTCAACAAACAAACAAAATATTAAATTCTAGATTGATTCCATC
GTGAGCTGGCATGAAAAGTCTTACATTGTCTTGGTCTACCAACGGAGACAAATTCAATCT
TACAAGGTAACACAAAAATGCAAAACCATATGTTAAATCAACGGAGGTACATTTTGGAGT
CTTCTTTAGTATATAGTTAAGATCTTTAAAACAAAAATTGTCTCCTATTGGTCAAGGCGT
GAAGGGTCTACAATGTCTTTCTGGAGCCCAGATTAGACGTAAATTTAAGGAACAAATCAA
CAAACCTTGTAAATAGGGAAACATAATTCTAATTCAAAATTTCTTTTTTCATTGGAATGC
AGAATTGTGGTGAATTCAACACCATCTGTCAAATCTTTTTTACAGATAATATAGATAATT
TAGAGAAGATAGAAAAGAAAAAAAGGATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..4308
1144..4308
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved