Arabidopsis_thaliana Locus mono:U30
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana mono:U30
Arabidopsis_thaliana
mono:U30
U30
1001..1086
2086
AAGCTTTTGTAAGTGGCCGCCAGTTTTATTTTTTAGTTTGATTGATTCCTTTTTATTTC
TAGAAAGTTCACTAACAAAAATTTAAATTAATAAAAACTTGTTGGCATGCGAATCAAAAG
AACAATGGATGATGACACACAATCTTGATGGAAACCAATCCCTTTAAGACAACGCTAAAG
ATTGAATACAACTTTTCTTTTGATTGGCTGTTGTATATATAACTTTGCACATAAGATATT
GAGAACAGCTCTCTACCTTCTAGGCCTCAATTCTTTTTTTTTCTTACTGAAATGCGAATC
CTGGTCTCTGTCCAATGAAAATGGTAATGCAGAAGCAAAAGAACAATAAGGCACAAAACA
ATATGAGAAAATGGGTTGATTCTGAATAATATCCGTTAGTTTGACTCTGAATTTTGCATA
TTTTCTTAAGTTTAGGTATGAAGTTCAAATAAAGATGCGGTTTGGGTATGAAAATACCTT
ACAAATTTTCATTGTCCTCTTGGTAATGCAGAAGCAAGAATACACTGAAAAATGACGTCG
TTTTGAACACGTCATTATCCACGTGTTTGCTGACTCAGAATTTTTACGGTGTTGACTAAC
ATCCGTTAATTTGACTCTAAATTTTGCATATTTTCTTAAGTTTAGGTATGAAATTCAAAT
AAAAATGCGGTTTGGGTATACAAATACCTTACAAATTAGTTTGGGTATAAAAATACATTA
CGAAAAAAATACAGAAAATACTATTTTCCCAAAAAAAAATAGTCCGTAACAGCGTGGTGG
GTAATCTCTCAGGTATTATAGGAGACATCAAACAATAATGGGCCAACACAAAAGGCCCAA
GGCCCATACTAAAGAGTCAACGACATGAAAACCTAGAACGAGACTTATAAATAAGGTGTG
TTCCTCTCGAACCCTAATTAGTCGTCACCTTTCTTCTTCCTTCGATTCAGTTGATTTTCT
CAAAAGTGTTTTTTTCTTTCATTTTTTCGGAACGATGATGGTGCAGTGATGATGGGTATA
AATCTCGTTAATCTGAATTTTTGTTAATGAAGATACTTACTTCCCAACCATTCATTAATA
TCTGAGCACCTTCGTCTTTATTCAGTTTTATGTTTTTTTGATGATCGCACATAGTTCTTC
TTCGAAGCCTTTAGATTCGCTCTAAAAGTGGTTTTGAGGATTTTATTTGTGCGTAAAGTA
AATGATCCTATCTGCTTGAGTAATCTCTGTTATGTGTTAACCATAGAGTTATGCTCCAAT
GTTATAGGATCACATTTATTTTATGATTCAAAAACTTTGCTAGGATTCATATAATCAATG
GCTAGTGTTTCTTTGAAAACGAGATTGAACTGAATTGGACTATAACAATACGAATGAGCT
TGCAATGGGACTTAATTAAGGCACCAATGAATTTGGAGATGCGAAATTTTGGATTGATGA
ACAAAAACTGTCACTGACAATCACAGATTCCGACTCATGAATTAAGGAACCGATGATTAT
AAATTTATAACAGTCTCAATTAAGAATCGATCACATAAATACAACTCCCCTAAAGAAGGC
TAGCAAGAGCAGTATATATATTACAAAAACCACAAGTGTTGGCATCTCTCGAGGGACTAA
AAACACAAGAGAAGCCACAACTAAACAATTACAAATCTTTTAAGTTTCACATTTTGTAAA
TGGAAGGGAAGAAGAACAGGCACTTTCTTCTTGGAAAAATGGGAGTAAATGTACAGTCCC
CCAAGGGATATTATCGTTTTGGTGGACTCACAATATTGTGTTGATGTGAAGTGCTTTGAG
GAGAGATGTTGCCATTTGTTTCACCAGAACTTGGCCTCCTGAACGTTGTCCATCTCGTCG
TTCTTCTATTAGATTCTGCAGTTTTTGAGGAAGGTCGTTCTCTACGATCAGCTGTTTCGG
CCGTGGATGATGTTCATAAACAGCCTGTTGTTTCAATGATCCCCAAAACCAAACAGTCAA
ACACTAGCAAAAAACTTATTAGATAATATTTGGCTATAGAATGATTCATTACCTTGATGA
GTTTTAGGAGGTTAAGTCGAGCAATCGCATCTTGATGGTCTAGCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved