Arabidopsis_thaliana Locus Poly:SnoR13-1
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR13-1
Arabidopsis_thaliana
Poly:SnoR13-1
5
SnoR13-1, U18-1, U54, SnoR58Y-1
1001..1078, 1147..1223, 1277..1340, 1405..1501
2501
GTCAATTTCTGAGTGTTGATTCCCCCTTCACCAATGCTCCCTCCTCCAGTGATTGGAGA
TTGCTCATATCTGCACCAAACAAACTCTAATCACTTAGTAACTTTCATGCAAACAAGCTA
TAATGTCTCATCGCCAGCAATTTTAAATTTTCGAAGTCTGACGAAAAGGGAAACTCACGA
TTCGCCACGAGAAGAGCCCAAAGGACGTTTAAATTGAGACCCGGTTGCGTAAATATCATC
CCTAATTCGCTTCATTGCTGCTCTGAGTAAAACAAACAAGAAAGATCATCGATTAGAGAA
GAGAAATGAAGAAATTTGAAGGTAAACCCAAAATCCCAATTTAGAAATTCCATTACTGAG
CATCTAAAAAAGGAAAATTCAGATGAAGTTGATAAAACCTACTTTCTCGTTCTCCAGATT
TCCCAGAGATATAACTCCGGGAAGAGATTAATCAGATCTCTCGAGTAAGAGCGGAATCGA
TAAGAAACACTTCCGATCAAATTCCGGCGAAAACTTCAAATTTCCCGAATTGTGCCAAAC
CCCAAGAACAATTCCGATGAGAACAGAGTGGAATTCAGAAGAAGATTAAAAAACAAATGA
GAGAGAAATGTTTTGAATTGGAGTTGCTACGACTGAGAAGCAAGAGAGAGAAAGTAATTT
TCGAATAATGAAGAAGAAGAAGAAACGAGGACGGAATTTGCCTATGAGGTCTCTCCCGGC
ACCTTCTTTAGAATTGTTTCAGCGAGACCAAATTATTATTATTTCCTTTTTTCTATTTTT
GGGCCGTTAAAATTTATAATGGGCTTAATAAAAGGCCCTGATTATTAGGCCCATTAAATA
AATTCGTAAGGTAATTAGGGTTTTGCTTCATCATATTCGCCGAGGAAGATATATAAAGAG
GAAACAGATAACATTACTCAGAGATATCGATCTAAGCTTGCTACATCTTCTTATATACTT
CTGCAGTTTTTAGTGTTTTTGAAATTCGGATTTTTTGTTTGGATCAGTTGATGAGCAAAT
ACTGCAACAATATGATGGAGAAATCTTTATGATTCTTAGTATTTAAGTCTCTGATGATCT
TATTTGTTTTTATATTTCCTCTCTTCTCCTTTTAGATCTTGCACATAGTCGTCCCTTTTT
CTGAACAGAGATGTGATGAGTAACAAATTGGTCCGTGTTTCTGATTAACCGTGACTGAGA
ATTTATTAACCAAACTCTGATCTCAATAAGTTTTATTATTTGAATCTTCAAATCTTGGTT
TTGTATTAGAAAAACAATGAGAACTCTTTGGTTTTTGGCTCTGTGATTGCTTCGCCTTAT
TGGCAATATACGCTATTCTGAAATCAGAGTATGAAAGATAAACAAACTGTACTTTATGAG
AGCCCAATCGAATAGTTATTTTGAAACTTCTGCTGTGATGATCTTTTGAATAAAATTCAC
ATGTCAGACTTCAGAGATCTTTTGATCTATGAGAAAAAACATTCATAATTCTGAGCAGAA
GTAACAACACAACCTGTTTCTCCAATACTAAAAATAACCAATTGTAACTTGTAGTAGAGC
TAAGAAGATATTAAAAAAAAGGTCGAACAGAGAGCTAATTTGATATATCCGTCTCATTCA
AATGCTAGCTTCTTGATCCTTAATCCTCATCCTCATCGTCAAGAGTAATTTCAAACCCAT
GTGGCAAGAATTTGTTAAATACGAGAATTAAATGGTTATGTCCCTTTAACAGGTCTTTGA
CTCGTGCAATCACGACAGAAGTATCGGTCCTGATAAAATGCAAGATGAAGAATGGGTTCA
GAGGCTAAATATGATACTTAAAGAAACAAAACAAAAAGATGTTATACCTTTGTGCCTTGA
AGTCGCTCATAATCTCGAGAAACAGATGGTATTTGTACTTTTGATCATGAAACACGTCCT
TTATTTCCTTTAAGTAGGCCAAAGCATCATCGGTTGTCAAAGCATCTTTGGTGTTACCGT
TTCCAGGTTTTGGAGATTGCCCTTGTCTGCGTCAAAAACAACCCCACGATCATCAACACA
ATACTTCAAGATTACGATACTAACCAAAGTCTTTTGCTAAAACGCAACTAGATTAAAAGA
TTTGAAATAGCATAAATGCGAAACCCTCTGTGTGCTCATCGCTAAGATTGAAAATGGAAC
TTACAATTCGTTTCGAGGGGAGCCCACTGGATGTTGATTTTGAGACCCAGAACCGTCGAT
TTCTTTATCTCCAATCCGCTTCATCCCTGATTGAAGAATTATGGGGGAAAAAGTTATTGC
AAGCAGAAGAGAAACAAAGAATCACGATGAAGTTTAGAGAGACTCACTTTCGGAGAAGAT
CTGAAACAAATCACTCAGATCTTTCAAGTGAGAGCAAAATCGAGCAGAATCACTTCGATC
AGCGACGATTCTATGCAAATCAGAACAAGAGTGTTGCGATGACAAATAGAACAAATTGCG
CCTATTAAAACCGTCCGTTTGCAACTTCTTTGGGCCTATATC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.8
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved