Arabidopsis_thaliana Locus Poly:SnoR13-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR13-2
Arabidopsis_thaliana
Poly:SnoR13-2
3
SnoR13-2, U18-2, SnoR58Y-2
1001..1080, 1146..1227, 1284..1377
2377
ACAAGCGAGTTTGTTTCGTGTAGAAGATGAGATGTCTGGTCCTCTACGTATTTCAGAAA
AGTATGGAGGTGGTGATGAAGAAGATGACGAAGAACTTGATTTCTGTGATGGATTTTTAT
CTTCAAGATCATTACTATTTCTTCCGGTTTGTTCTAGATGATTTTGAAGAATTGCTCCAT
TTTTTTGATCTAAGATGAATTGATCACTCCAAATACGACCCGAAGAACCTTGACGTCGGA
ACGAAACAGCTGATCTTTGTAGCGATGTCATTACTTAAGTTTTGAATCTTGTTACGATTA
TATCTTCTTTAATACCAAACTTATTTTATTCTATCAATTTTGTTGTGTGTTTGTTTCTTT
TGCGTATGTATGAAGCTATTGTTTCAAGTGTTTGAACTTGTTTAAAGATAAAATGAACAG
AATTAGTTGAGTTTGAAATTAGATTTTATCCAGTTTTGGATTTACTACAAAACATGCTAA
ATTAAGCTTAAAAGTTTATATCTACTCCCCAAAAAAAGGATATAAATTTTGATCTTGTCT
TCCATTAAAATAGGATCCAATGACTTCAAGCCTTAAATAGATGTAGATTTTCTTACAAAT
TATTTTGTTCCAAGTACATATTTTTTTTTAAAATTAATATTTTGTTTTTTCTTGAATCAA
ACCAAAAATGAGAAGTTGTAAATTTTCAGTCAAGCCCATCCATATAAGCTAATTGAGTAT
TGGTTTGGGGTTTTTATGGGTCAAAAGAGGTTTATTATAATGGGCCTTATGAAGCTCATA
TACGACCCATAAGCGTTAGGGTTTTCCTCGAGAAACCTAAGAATCGCCGCCATTGGGGAC
CTTTATATACAAACCACACATGACTTTGACAGACATCAAGCTCTTATCAAGTCAGTTTAG
GGTTCTCTGTTCAAGTTCGTATTTTATCTTCAGTTTAGTTTTCTTTAGATCTTTGGTTTT
CGAGTTATGATGTATTGGTCCGTATAGATAATGCAAAATTGAGATCAGGTGATGAGGTAA
TACTGCAACAATATGATGGAGTAATCTTTGTGATTATTAGTATTTAAGTCTCTGATGATC
TTAATCGTTTTCAACTAGATCTTTTTCGATTTGATTTTCTTCTGTTTTGATTGTTTTGTT
TGAAACGAGAGATATGATGATCAACAAATTGGTCCGTGTTTCAGATTAACCGTGACCGAA
AAAATTCTTAACCAAACTCTGATCTCTCTTCTTTTCTTTCGATTTTTTAGTATTTTCCTT
CAAATTTCGTTTTGGATAATTTCTTCTTCTGCGGTGATGATTTTATGAGAAATTCACATG
TCAGACTTCAGAGATTCTTGTAATCTATGAGAATAAATTCATATATCTGAGCAGAAGATT
CGAATTATAAAAGACTCACACATATACATTGACCGTTTACAGAGATGGAATCATAGAAAC
AAATAGAACAGTTTGATTTATTTAACCAAATAGTTCAATTAATGGAAGAGGTTCAGAATC
TGGTCTTCGGAGTTGTCATACTATTTAGAAATCTGGTCTTATAATCTGAACAATCCTAAT
CCCACGGTTCAACAAACTTTTGACATGGATCAAACATATAACAAACCATTAACGATAAAA
GACTCAAATCAAGCGAATTAAAAAACAAGACTCAGGTCAACAAACCATATTAGCCTACGT
TGCATCACGATAATGAAGAATAACTTATAGATCCATCCCCTTTTGTCTCCTAATTCTTAA
TTTTTTAGAAAGAGATCATTATTGTTCTCGGATGGAGATATTTAGAAAGGCAACGATTGT
ACGTCTCCGTAGCCACAACGACAAATACCTAAGTGCCGATGAAGATCAAGAATCCGTTCA
TCAAGATCGTCGCGGCACAACAAAAAACACTAGATGGACGGTTGAGATCGTACCTGGATC
CAATGTGATCCGTCTTCAAAGCTGTTACGGCAAATACCTTACCGCCACTAATATTCATTT
CCTCCTTGGAGCCACCGGCGAAAAGGTAGGTTTATCTAGGGGAGATTGGGTTACAAGAAA
CCATCTCAAATCAAAATTAGGATTCTTTTTCAATAAATTTCTTGAAAAACAAGGCATCCA
AATCCATTGATAACATTTATAAACACTTTGACAAAGTAAATCTTGCCCAAGAGATATTTC
AAATGTTTAACAACGAGAAAACCCATTCTTATGACTATAGCGCAAACAAAAACGCATAAA
CAGAATTTTTTTAAACGTGGAAATGTTTCTTGCTAAACAAGCCGTGTGTGTTTCATATTC
ACAAGGTACTTCAAACTCTACCCGAAAAGTTGGATTCATCTGCGGAGTGGGAGCCGCTAT
CAGACGATGGTGTACACGTACGGTTCAAGAGTCGCTAC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003074.8
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved