Arabidopsis_thaliana Locus Poly:72Ya
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:72Ya
Arabidopsis_thaliana
Poly:72Ya
SnoR72Ya, SnoR72Yb, SnoR72Yc, SnoR72Yd
1001..1082, 1159..1240, 1320..1401, 1485..1562
2562
GAGCTAAAACCCTCCGCCGTTAAAAACCCTAAAAGAAATCGAAGACCATCACATGGTCC
GAAGAAAGATTTGAAGAAGAAGAAGACTAAGATTACTAAGAAGACTAAGAAGTCGAAAGC
TCCCACCTTTGATAAGACCATTGAGAAGAGTAGAAGTAACGACCAGAAAACCGACAACGA
CGAAGACGAGCAACTGTATTCGGAACCGGTATCGGCCTCTGAGCAGCTCAACTACTTTTT
GAATCATCTTGACTCCGCCATTGGTATCAAGGTTTCTTCTTTAGAGCTTGAACCCATTAA
AGGTTCGTCCTTTGTTTTATTCTAGCTTGGTATTTATGTACTTCTGTTTAAGTATATCTT
ATTGGGTTTAGATATAAAAAAATACGAGCTTTGATTGTTCATTCGACTTATCAATGCACA
GATTTCCCAAGTTCTGATGAAGTTAAGATTTGTCTGGTTTAATTGCAGATACGTGTATAG
TTGAGTTATCTCAAGGGTTGGATCAAGATGTAAGCAACTTGGGAGAACATATAAAGCTTT
CTTGTGGGTCTTCATGGAGAGAGACTCTTTGTGAAGGAGAGTCACTTGAAAGGAAAGTTG
AACCGGGAAACCCATCTGTTCTTGTTATTAGTTCCTCTGCTCTGAGATCTTTGGAACTTC
TAAGGTACATTGTAAATATGTGTACTTGTATCTTTGTTATTGATTGATATAATGCTTGAT
TGAATAGAAAGTTGCTTAGACTGAGTCCTGTCTTATGTATGTAGGGGTTTGCATTCATTG
ACTAAGCAATGTCCAGCAGTGAAGTTGTTCTCAAAGCATTTGAAGGTTGAGGAACAGGTA
GTGTTTTATTCTTATAATGATTTGTCTATAGAGAACTGAACTTAATTCTAAGCACATAGA
AAAGAGAGAACAAATTGAAACTGGCATTTTGAGTTATTTCGTTATTGAATCTTGTTTTGG
TTCTCTTGTGTGGAATGCATTGTTCTTGCTTCTCTGGAACTTGGGATATGATGACAAAAA
TACGATATCTCTAAGGCTAATTGCTGTGCGGATGAAATGTATTTGCACGTCAGTCTGATC
CCATTATGTATATAACATTAGGAGTTGGTGCATGCTCATGTAGTTCGTTTCTTTCATTTT
TAGTTAATGTTAAGGATTTGGGAAGTGATGATAAGATATATCAATATATCATAGGCACAT
GCAATGCTGAACGATATATATTTGCACGTCAGTCTGATCCCTTTATATATATATAACATT
AAGAGTTGGTGCATACTCATGTAGTTCATTTCTTTCTTTTTTAGTTCATGTTAAGGATTT
GGGAAGTGATGATAAGATATATCAATATGTCATAGGCACTTGCAATGCTGAACAATATAT
ATTTGCACGTCAGTCTGATCCCTTTATATATCCATCATTAAGCATTTATGCATATACTCA
TGTTATTCTTCCCTCTCTCTGTCTGTCTTTCATGTTAAGAGTCTGGGAAATGATGATAAG
TATATCGATATTTCAGAGGCGTATGCAATGCTGAACGAACTATTTGCACGTCAGTCTGAT
TCCAGCTCTTGTTTTTGTTTCTTAATTTGCATATAAGAAGACTATAGAATTAGATTCTTC
TGCTTTGGTCTAAATATGAAACTCTCATTTAAAAAAGAAATGGTTTCCGAAAATCTTTAT
ATAAATTTCTCAAGCTCATTGTTATATGACTCGAATTATTAACTCTAGTTCATTGTGTTG
CAGGTATCTCTGTTGAAGAAACGGGTTAATATTGGGAGTGGCACACCAAACAGGTTAGTA
AATCTCATCACATCCTTTCATTGTTTCCCTTTACTTGTATCTCCATATCCTTCTTGCTCT
AGATCCTGACTGTCCTCTTGCTCTTCTATGCAGGATCAAAAAGCTAGTCGACATAGAAGC
TTTAGGGCTTTCGCGTTTAGATATGATTGTGATCGACATGCACCCAGATGTCAAGGGATT
TTCCTTATTCACATTGCCTCAAGTCAGGTTTGGTTTCTCAACTCTTGAACAAGCTGCCCC
ATTATCATCAACGAGTGGAATTTTTTCTGATTTTTGTTCTGTTATATTTGCAGAGATGAG
TTTTGGGATTTGTATAAAAACTGCTTCCACCAGAGAGTCCTAGAAGGAAGACTTCGTATC
TGCATGTATGGTCCAAAGCCTTCTCCAAACCTAAAGAAGAAGAACAAGAAATAACTGTTT
ATTAATTGTATCAAATTCTTAAAATTAAAAAACAAATCTAATACTAATCTCTTTTTTCAT
CTCCAAGATTTTACAAAGAATTCTAACATAACCCAGGATATGAGATTTCTTTGTTCGAGC
TGATTATCCCATATCTTTGTAATGTTTCACATAAAAAAATAATTGGACGTCGAAGACCAC
AAATCATCATAACACTATTTGCTGAGCTGAAATGAAGTCATAACACTACTTACTTTAGAT
TCAGGGTTAGTGCTCAATGAAATGGAACTTACCAGCTTTTTCATTAAACAGGTTATAGAA
AGAAAGTAGACAAAAGATGCAAGATGAAGTTGCTGGAAATGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved