Arabidopsis_thaliana Locus Poly:SnoR68Y
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR68Y
Arabidopsis_thaliana
Poly:SnoR68Y
2
SnoR26, SnoR27, SnoR68Y
1001..1094, 1147..1243, 1312..1404
2404
ACGTGGTGCCTCCTCCGCCTTCTTATACATCGACGGCAACAAAAACTGCATCGTCACCA
ACTTCTTCCTTCCTTCTCCACCACCTTCCTTAGTTACAACCGGAGAAGTCATCTCAATCT
TCTCACTCTCCTTAGTAATCACCGGAGCAGTCATCGCAATCTTCTCACCTTCCTTAGTGA
TCACCGGTGCAGTCATAGCAATTTTCTCCGGTTTCTCATTCTCCGGTTTGCCAAACACAC
CTATGTACTTAGCCAAAAGCTGAAAGCCTCCGTCTTTATCACCTTTGAACTCCGACGCAT
CGTATGTAACCTCCGCCGCAACCGCTGGTGGATATTCACGGATCTCATAACCGTCACCGG
ATTTAGTCACCGTGTATTTAGGAGTCTCTACAGCGATTTTACCAAAAACCATTCCCATTA
TGTAAGTTTTACCAAAAACTATTCTCATAGGAGAAGTAGTATTTATCAGTTTGGTTCTTT
CGGTTACTAAACGCAAACGTGTGGTTAGCATTTGACAACGTATGTGTATAAAAATATTTC
AATTTATTTATAGAAGAAGATATGATAAACTCAAATCGAATTTTTGGCTTTTTTTGTTTG
AAAAATCAGAGACGCGTCATGGTTAATTATTTGCTTTATGACTAAATTTACAGAAGCAGT
TTGACACGTTTCTGGTTTTTGTGGTTCAGAGCATTCTTTCGTTACGTGGAGGTTCAGGTT
ACACGACAAAGATGAGAGACTATTCTCGGTGGTCTAAAAAACGACTTTGTTTTAGACAAA
ACGGTGCGTAGTTGTTTTTAGAAAACGGCAGGTAGTTTGCGTCTCAAAGGATATATCTGT
TACCAAACAGAAGAGTAGGGTTTTGTCTTCGGCGGCTTATATAAATAATTTTCTCGAGCC
ATTGAATCTTAGAATCTGTTCGTCGATTTGTCTGATTAAGCTAGGGTTTTGATAGATTTT
CTTATTCGATCTTGTTTTCTTTTGGTTTATGTTTTGATAAGAGAGCATCGGTGATGAATC
CATGAAAAAATTGTTATCCTTGCACTTTGATTGCTAGTGAAGAAACAAATGGGGTTTTCG
ATGTCTGAGATGCTCATTACTTTTTTTGTCTTCTTTGCTCGATTTTGCTTCGTGTTAGAC
TGTTAGGATTGGATCGATGATTGATTAGTTAAAATACTGCGTTATCTTTCTGCAAATCTC
CTATAAGGATTTGAAGACAAATCATGAAAAACCTGAGATCCAATGTTTTTCAATCAATTA
TCCAATGTTTTTCAATCAGTTGTTTTAAATCTGGATTGGTTGATGGATAGAATCAGATCG
ATGATGTCATATTAAACTGCGTTATCTATCTTAAAATCTCCGAAATAGGAGTTGCAGACA
CTAAACAGAAAACGCTGAGATCTGATATTAGCCTAATTTCAATTGATAGTGTTTATGACA
ATGGCTTGTTGTTTTGTTCTTAATGTTAGTTTTTGGATTCTTAATTAACGAGTAGTGTCC
GAAAAAAAATAAAAAAAAATAAAAAAAATTAACGAGTAGTGTTATACTGAACATATTCAT
AAGAGTAATGCATTAATATGATTGGCGTGTTCGAAAGAAGAAAAAAAACTGCAACAGAGC
TCGGCTGATGCAAATTGTGAACTTGTATATGATTGAACCAAACCTGACTCAAATTAAGCC
CTTTAGTTAGGCTTTTGATTGCCACAAGCACACAAGGCACAAAAGCGCAAGCCAAAAAAA
ACAAAAGAAAGCCTTGTTGAAGAAAACAAAAATCAAAAATTTTGCAAGGAATGATCGAAC
CCATGAACTGGTTTTCTTACTCTCAGCACCTTAACCAGTAGAACTAACTGCAGTTTCAGA
AACTGTAGTGTAAGAATGATTTATCAAACCAGACAGTACAAAGTAGTTAAACCCAAATTA
CATAAATTTCTACCAAAGTTATCAAGATAAAAAAAAACCATAGTTTAAATTGAACCGAAA
TTTTGACTAAAGTTATCCAGATAAAGAAACCAACGAACCAGCCGAAACCAGACGGTCCAA
AATAGCTAATCGCAAAAATCTTAAAATCGAACGGTTCCATAACAATATATGGTTTTCCAA
TTTTGTCCCTTACAAAAAATTTGGCATCACCCGCCACAAGAAATCTCCCGGGAAAATCGA
AATAAACCGTTCCAATTCCAAAGCTTCTAAAATCTCCCGCTAGTCCTTTACCTTCTTCTT
CTTCTTCTTCTAATCAACTTCTCTCTCCCTCTCCTCCGCTTCTTCACATTCCGATCATTA
GTGTTTTCGGAGAAATGGCGAGATCAAACAGATCCAAGACTTCAGAGCGTATAATAGGCA
ATGGTGAAGTTACTCCGATTCAAGTCGCCTTCCTCGTCGATCGATACCTCTGCGATAATC
GCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003071.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved