Arabidopsis_thaliana Locus Poly:39BYa
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:39BYa
Arabidopsis_thaliana
Poly:39BYa
2
39BYa, SnoR21a
1380..1459, 1501..1579
2718
atgatcactaagttaccattatttagtactgctttaaacaattttcatgtttgataatg
aggaaatttagtaatttagaacattgtacaaaagttataaagaaactcttagaaagattt
agaaaaatgggctttgcaatgactattgagacggtacgtgtatccaatagtggggttggt
ggtctatggaagtggtgtggtgcatcattgcatggggttggttaaatttaaaagtcattc
atttgtgtaatcatggttctctgtttccaccgtaacccaaactaaattgttgacaactaa
gagtttttaaacaagtaaatcattattaacttgagatcatcaaaggtaaaacaatttcta
tgcgtccaaacatttacattagtatggttctaaccattgttctcagaggatcttacataa
aacttgatattgtgtaaccggttcgcgaggcttctagtgctaaattacatttgtatgttt
tttttgttgacgtaaattgaaaactccttcattgaaaaatcgttggccgaatgttaagct
aggaaaaataataataatgaactaggagccactaacaatgtgttgaaatttaagtcgaag
tcgacactgaacacacacacattttataagcatgggtgaactgcatgagacccacacttt
acattacacaagtccgagaccgagatgggattagtaacctcatgtgcagtgtcaccttcc
taacttgtaaaagtgtacaaccttaggagggttgtttattcagtctgatggcccaacaac
atattacaatttacaacaatttgaatgggtcttataaagctacaaataaaaataaaccta
atgggcttaattgggctctctcgtagaattaacaaaaggcccgtgatgttaaaggcggtg
tgattctttagggcttcctcaaaaccctaatctcttaggtataaattgacacaacgcacc
accttccttctcatcttcacttcttcaaccttttccactctTACGATTCCTTAAGAATCT
CCTTCTAGCTTATCTTGTATTAATTTTGAGTTTTGTAGGGTTTAGGTTGTTTGATTAAGT
TAGCAAGTTAGGGATTAGTTACGTGACGAGATTTCTCTCCAAGGAATCTATTACTAAAAA
GATGGAGCAATCTGAAATTGTGATTGCATAATCCACTAGTAAACGTCACAAAGCAATTGG
GCATGCCCATGGACGTTGATGGAGCTCTAGGGCTTCTCCGTTTTGGGTATCTTGCTATTG
GCTCTCATATTCCATTGCCTTGCGGAGCGGCGTCGCTGCTTTTACCGTTTGGGACCGGCC
ATGAGATCTATATTCCCCTGTATTTTGGTTTTCAGTTTTATCTAGTTAGGATTGTATTTA
GCCAATGAGGACATCAGATTATAAAAGAACACCATCTTTCGGGACTGATTAACATTGATG
ATACTTCTGCAATTCTGAGGCTAtttttttgatgagttttgtttttgattagtatagaaa
aggcagtgatgaacgagaatgtcatgcaccactctgatattagtgctgataaccatctct
aacccatattttctctgagcctttattatttctgaaattttttttgtaagtttataagat
tgaaaagggttttaatagccagatgatggtcattataatgacttgaccttgatgcggact
gtatttctttgatgataacttttggttgctgatggttatattattacccttttacagttt
tacattttgactgatttggttttgtgtttacatatttttaacgagggacacaaattgtgt
attggttatgtggttggctttgttttacagattcagttaattgatgtgatcttcgacggg
tttgtcctaactgtagctgtgggtgatgatagttctgaaaatctagtctggatgttattg
atgaaggtgtttggctcattccattatgtctagccgcttgagacgtttccgcagtttatg
acctttagtttatgttcgttttgttatgttcccgaagccggtaataaaagtgtatttctg
aaactactacgccttgtattcaatagataatattcatattctacatttgatttctacgtt
tcttgtaacccagccatacattaatttatcttgtaacttataccgaaacgaagtaaacta
ttattagtttcttgtaacttgatatccatcaatctctgatgtctacgaagaataaaaaga
tgagaaagtctgtgatttccttacgcgtacatcttattttaagcaatcatcagcttcacc
ttcaagttgtcagaacaagggaaagacaggctgcttgtcaagatgtcttaattggtgttc
ccattttcgacgaagaattcttgtgtgataatcttttctaatcacaacatctttacctat
acttaattcaaacactcttgaatctaattggtagtagtatcagaaccgattaaaaccaaa
ttgctttatggccaatcgattaccctgcaaatagtaaaatccaacatcaaacaacttata
aaaatgcggtgatcgttgtcttctataagtcccgatcatacctaaattcgtgtataaaga
aaacactggaacacactcataagtcatgactgatagcgtctcactcgtatccaccagcgc
cactagtggaactcatgcacattttgctagattaaaaaaaaacgccaaagtagtagcatg
ctctctatctataacgtta
  Untranslated Region
  Coding Sequence
  snoRNA
CP002685
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved