Arabidopsis_thaliana Locus Poly:39BYb
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:39BYb
Arabidopsis_thaliana
Poly:39BYb
2
39BYb, SnoR21b
1001..1095, 1137..1219
2219
GCAAATAGTAAAATCCAACATCAAACAACTTATAAAAATGCGGTGATCGTTGTCTTCTA
TAAGTCCCGATCATACCTAAATTCGTGTATAAAGAAAACACTGGAACACACTCATAAGTC
ATGACTGATAGCGTCTCACTCGTATCCACCAGCGCCACTAGTGGAACTCATGCACATTTT
GCTAGATTAAAAAAAAACGCCAAAGTAGTAGCATGCTCTCTATCTATAACGTTAAAACCA
AATAATTCAAACGTAGCTTAGAACTTCATCTCTGTTGGTTGTATCCGGAATAAAAAAATT
CTTATTTACACAAATTGAGATGATCTGAAAATATATGTATCCCTTCTGGCCAAAATATGA
AAATTACATGACTGATGAAAAACTGCTGACTCTTTATGTCACAAGTTGCAAAATTAAATA
TTTAATTATTTTACCTTTTAAAAATAATTTAGTTACCTTTAATGGGCTTGCAGAGCAAAT
AGTTTGGGCCATGAAGAGCAAATCTATTGGGCCATTAAGGCGTATAATTAATTCCCAAAG
GCGGTGTGTGTCTCTTCTAGGGCTTCCAATTTCTCTTGTATATATACATATCCGCGCGCA
TTCTCTCTTCTCATCTCATCTCATCTTCGTCCTCCTCATTTCCTTGGATTCCTTATTCTT
TGTTTTTTTTTCTTTTGTGTATTTGTCTCGATTTTGATTTTAGTTACGTGACGAGATTTC
TCTCCCAGGAATCTATTACCAAAAAGATGGAGCAATCTGATAATTGTGATTGCATAATCC
ACTGGTAAACGTCACAAACCAATAGGGTAAGCATAAGGACGTTGATGGAGCCTTAGGGCT
TCTCCGTCTTAGCTATTGCCACTGGCTCTCATATTCCATTGCCTTGCGGAGCGGCGTTGC
TGCTTTTACCGTTTGGGACCTGCCATGAGATCTATATTCCTTTCTTATTCTCAAAAGTTC
TCTGTTCTTTTGGTTTTCAATTTTTCTAATTAGGGTTTAGTAGCCGATGTGGATATCAGA
TTATAAAAGAACACCATCTTTCGGGACTGATTGACTTCTTTTGAAGTTTTGCTGATACTT
CTGCAATTCTGAGGCTTTCTTTATTTGTTTGGTTACTTGTGGTTTGATTAGAAGTAGAGG
CTGTGATGATTGAGAATGTCATGCACCACTCTGATTTTTTGTGCTGATAATCATCTCTAA
CCCATATTTTATCTGAGCCTTTTCTGAATTGTTATATGACTTTTGGTTCTGAATGGTTAT
TACTACCCTTTTAGATGTGTTGTCTGAATTAGATTGATTCATTGTGGTGCACTTATGAAT
TATATTTGTGTGAATGGTTTTCTACTAATTGTTCACATTGGTTGGCTTTGTTCGTAATGG
TTATGCTGATGGGAGCTTATGCGGAGGGTTTGGAGGTTGTCTCATACGTTGATTGCTTGG
TTGCGGAAAGTTCTGAAGATTCTGTCCGAATGTTGACTTTTTGGTTTCGGAAGGTTCTGA
AGATTCAGTCCGAATGTCATATGGTTAAGAGCGTAGTGAAGATATTGTTACATTTTACGA
CCTTGAATTCTTGTTATAGCTAATATGAGTATTTGTACGATTTCTAATTGTTATAGCTTA
ATATAATGAGACATTGTTTTTCCCAAATTTCAAAAGTTTTATCTTGGATTGCTAATTTGT
TATACCTGAAATCTTAAAACATCAGTGCTGGATATTTTCAAGGCGATGTAGATGTTCCTT
GCGTGCTTGAAAACAAAAAAAATCCAAACGATTCTTTTCAGTTTTCATCAATCAATTGAG
CACCTGCTTCCTTCAGATTTATATCACTATGAAATTAGACTTTGACCGCAAAAAAAAAAA
GAGACTTGATGGACTTAGGGTAGCAGAGAACTGTACAAGGTGTTTAAGATTCTGAACTGT
CCGAATTGGTCTTCTGTCTTCAGTTTTGTTTCGAATCCCTCCCATAGATGTATTATATAA
GAAATGTAGGTTATGTTCATGATTTCTTTTTTTTGGGAGCAACCAGGTTATGTTCCAAAA
ATAGTATGGTTACAGTTGTACAAAACAGCAACTAAGGAGATAAAGTTTTGAACAGTTGAA
TGCAGAGGAAACACTCATAACAGATTTTTTCAAGTCAATAACAGACACTTTTTTGCAAAC
TGTCACTCTAGCTAATCATTAAAAACTGGATATTGAGCCTGATTTGTTGTCTTCGAACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved