Arabidopsis_thaliana Locus poly:U34a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U34a
Arabidopsis_thaliana
poly:U34a
U34a, U34b, U34c
1001..1079, 1140..1221, 1266..1365
2365
CATCAAAGTTGTCGGCAAATCTTGTAAGAAGGGTTGGTCCAAAGTCAAGAACCTTCGTC
GTTAGATTCTTCATTCTTGGCCTCTTCCATTACATCCTCTCCCTAATAATCTCTCTTTTG
TCTTTGTTTTTGTTTATTTTTTTGAACTCTCATACTAAAGAGTTTTGTCTTCTTACTTTT
TTTATGGGTTTCATATTTATTTATCTCTAAGTCTTTCTTAATTGTTGTTTTCTTCATTAT
CTTTGTTTTCTCCTCCTTGGATTTGTGGAGGATGTCAATACATCTTCTTTGATGGATATG
AGATCTACTAATTATGATGCTAGAATTTACAGATTCTTTTTTACCATTCATTTTAAAGAA
AAAAATAACATATTGGAGAATTACCTAAATGATTCTCTTTCAAATTTCAGCTTTACTTTA
AAGATAAGCCTACATGAACCCTAGATTTTTCCTTTGCATTAACATGAACCCCATATTTTT
TAAATTTGAACAAAAGGGAAAAACAAAAAGAGGAAAAAGAATAATGAAAAGCTTATGGTT
ATTTATTTTAAATGGCTGTTTTATCAAAAAGTTGAGCTTTAATGGGCCGGTATGGGCCTT
TTTCCCAATTAGAAATTCGGTCGAGCTTTGATGGGCCGATATATGGGCCCTTTCCCAACG
CTTAACGCCACAGTTGCAATATATAATGTTTGCTAGGGTTTCAAAGGAAGAAGAAGATAT
AAACAAACTCTTGGTGGCGGTGAGAAAAAACCATCAGGGCTCATGATCGATATTCTCTGA
ACTAGAGAAGCCAGTGAGCGATTCAGTTTCCATTATTACTATCAAAGCTTCGTACTTTTT
GTTTTCGTCGCATGATGTCTTGTAGTTTTCTTGTTAATTGATAGAATTCTATTCATTGAA
TTAAGTAAAGTTGTGCTTTTTTAGCTTTTTCTCTTTGTGCTTTGCAAAGTCTTAACCTTT
CTTATGTTTTGTTAGTATTTGTGAACTTGGGTTTAGATAAAGAGCCAGTGATGATTGAAA
AAGATTGTCTACATTGTTTGATGTACCACTGAAATGAATTCTTTAATTAGTCTGAGGCTC
ATTGCTCCTTCAATTTTCCTGTCTGAGATTTGTATCTCTCTTTGCCATTGTTGCAGCTTT
AAGGCCTATGATGATTCAAATTTTGCCTACATTGTTTGATAAACCAATGATATAACTTGT
ACAAAATGTTTTCTGAGGCCTTTAGTGTTGTTTACTTAGAGAATTTGATTATGATTTTTG
ACGGTGTGAGGCTGGTGATGATGTTTCATATCTTTGCCTACATTGCCTGATCAAAGCTAT
TTTTGGCTTTGAACAAGTGAGTGAATGATAAACTTCTGAAGCCTCATGAGTTTACTATTG
TTAATTTTGCCTAGGAGGAGTGCTAGTTTTGTTGTAGTGTAGAGATTTTATATGCTCTAT
GTTGTTGTCTCCAACGAAATCCGTGAACTTGTTTAAATCTTACCATCTTAGTTATTTCGT
AGTCGTTTGGTTGTCATACCTGAAATCTGTAGCAATATCTATAATAAACGAACTCGTATG
TCAAATCATGGAAAATGGTTTAGAATGAATCTTTTGCTTGTGGAAATACTGGATTTGGTT
TCGACCACACAAAGAAACTCTAATTCCTTGTTCATGATTTGGTAATACTTCCATCTCTTT
GTCTTAACAATATGTAGAGGAAGAAGGATCACAACTGAGAATTCAAGCCTTGGCCTCTCC
TCTCCTACTGGAATTTTATTTGGATGTGTCATGTTTCCATTTAACTTGTATTGTATGTTG
GGTAAATTTCTTGTATTTAGAAGAGCCACAAGAAAATTTGGTTCTGACTAATGATTGTAT
GCTATTTTGAACTTGTTCCAACCACATTGTAATTTGGGGCTCAGTTCCATGATTTCCCTA
TCATTTTACTTGGAACATTATCTGCTTTTCCCACTATTTAACAAATGTCTTGAGTGTTGT
TGACCATACGCCATTTCTCACATCCAAAACACAATGACATAAACATGACAGACGGGGCTC
TAGCAGTGAATCAATCTATAAGATTAGCTCACGTTCTCTAAGCCCAATAACATACAAATC
AAGGCCCAATCTAATAAGTGTAATCCAACGTGACTCAGAAGTCAGAACATCCTTGCTAGT
TACTATAGTTGCTACTTGCTGCGTGTCCATTTGTCATTTGTAAAATTGTCCTTGTACGCC
AAGCTAACCTTTATTTGCTTAACAAGTAGGAAGATAGATTTTAGCTTGACCTCCAAGGCA
GTTCTACAAATGACAAATGGAAAGGAAGAGTCAAACTTGGTGGTTTATGATCAACTTTGT
TATCTTTCGTTTACTTTGAATACATG
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003071.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved