Arabidopsis_thaliana Locus poly:U49-1
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U49-1
Arabidopsis_thaliana
poly:U49-1
U49-1, U65-1, SnoR77Y-1
1001..1216, 1248..1396, 1437..1515
2515
TTGTAACAACTGTTTAAGTTTGGTTTTTATTTCATCTCCATCGTCGAAAGCTTTGACCC
TTTTTGGGTTTTTGAAAGATCAAATCATCTTCCAATATAGTACAAATGTGATATACAAGT
TGTGTGACAATCTTCCACCTTTTAGTTGTTGTTGCTGTTGTTAGTACACAAACGCATACT
CTTCACTTTGGTTTGTTAAACTTTTTAGCTCGGCTTTGGTCGTCTTTTCTCACATGCATA
CTTCCAAATTGGAGTCATAGCGACAACATTAATACAACTAGTCAACTACTATGTTACAAG
TTTCTGTCCACTAATTTCTTTCTCTAATTACATCTGAATCTGTAAGTACATAAACATGTA
TGTACATATGAACACATGAGTGTGTGTATATACACAAAAATTTATGTAATAAAAGAGCAA
TAATTGATGTAAAATGTGGAATACTGTATGATGATAGCTACTAAGTCTCAATCATGTAAT
CAAAGTGATGTCTTAGAACCAAACTTAAGGTTGTTCGAAACAATCAATCATACATTGGTC
CCAATGTGGTGGATTGGAACATGACAGGGAAACCATGTGCTCCCACTTATTTATATATAT
GCATCGTATGTTCGTATGTATTAATGTATATACATTTCACACCACATGCAGTGAGTTATT
TATGTCACCTTTTATTTAGTTTTCCGAAAAATGGTGAAATAGATTGGTCAAATTTCGTCT
ACAAAGTAAATTAAAAAAGATCATTAAATCAGTCGTTACGAGAAAATAAAGCACATCCTC
ATATATCAAAGATTAAAAATATAATAAAACTAAACAATACATGTACGCACACGTAGAAGA
TTAGGGTTTTGAGTTATGCCGCCTCCTACCATCTATATAAATAAATCTAGCGTCTCTAAT
ATCTTCATAAACCTCTCAAACTTTGCTGAGCTTGATTATTCCATAGATGTTTGGTTCTTG
ATTCTCTATATCCTACTCGTTTGTTTTGTATAGAAGTTTATTCCTAATGAAGAAGCAATC
CCATAGATAGGAAGTGCCGTATGACACTTTACACAACAGCGGACTGAACGAGGATGCATC
CGGTGATTTCTCATCCCCCGAGCAGTTTTCCTGATCCGTTTACGGTCGGGTTCGAGCTGC
TCGGTCGGGTTATCTACCGTACTTCCCACCGTTCTGTGTCCACTGTGTGGGTGATTTGAC
ACGGGTTCGCTGAGGGGTAACTTGATTTTTTATTAGTTATGATGAAAATGTCCGATGCCA
CGTCGACGGTAGCTATTTTTGGCAATGATCCTCGATGCTACATTGGACATAGACAAATGT
ACGTGTTTCGCTTACTGATAGGAACCTGTGGATCTTGATTCTATACGATCTCCGGAGCCA
TTTCGGCGATTACATTTTTTTTATATAATTGATTTGATTTGATTATTGGGAAGATTACCG
ATGATGATTATTGCGAAAATATGGAATTACCGTCTGAGTTAATTTCTTTGATGTTAAAAA
CGCTGGCTAACTGAGGCTTCCCAATTCATAAATCAACTCTTTATAATACTACTTATATGT
TGCACATCCGCAAACAATCTTTTTTTGATAATTATGTTTATAAGTATTTTTATTTTTATT
TTTTTTAATTACCATACAATAGTCTTGATTGATTCCTAACAATTAATTTTAGGGGGTGTT
ATTGGTTTCCAACTTTAAAAGAGTTTTAATGATTTAAAAAAAATAGAAATAGTAGACAAA
ATCAAGGATTTTAAATGATTACTAGAGAATTTTGTATAATCTCTTTGATTACCTTTTCCA
TAGTCTTGTAAAGTCTTCTTAAATTAAAAAGATTTGAAATGATTACTTGAGATTTTATCT
CTTTGAAATATTGCTTTTCTCATATTTTATAAAATTGTCTCGTTGAAAGTTTTACATAGG
TTTTGTATATGTCAAAAGTGTATTACTCTCCCAAAATATATTATTGTGCTTTTGTTAAAG
TTTAGAGGTATGTAAGTTCTCATATAAAAGATTTTACACATAGTTCACAATTATATAGAA
AGATTAGAGAGAGGTCCTAAAAGTTACGTTCATGATATTTCTTGAAGAGATTAGGGAGAG
GTCATAACGTTACTTTGATTGGTTTTTATTTAATGGTTAAGCAGATGATTCTTGTTAATT
CTAAAAATCATTCACAATCTCTCTGTTCTTATTATACTTTTCATGATTTCATTTTGTAAA
GAAAAATGTATAAAGCCATAAACCAATAACACAATAATTTAAATCATTAACAATCCTAGA
TACTTTTGTTTTAATTGAATAACACAAAATTTTCAATGACTTTACTAAAGTATCAATGCA
ATAACTCCAAATTTATCAAGATTTTATATTACTTTTTACAAATCAGAAACTAATAACATT
AAACTTTAACAGAATCTTAAACAATTGAATAACAAAAGATTTTTCCTAATATTATAAATC
ATTAAAAGTCGATATAAATTACAGACCAATAACACCGTCTTAATTAACTGATAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003071.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved