Arabidopsis_thaliana Locus poly:U49-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U49-2
Arabidopsis_thaliana
poly:U49-2
U49-2, U65-2, SnoR77Y-2
999..1241, 1268..1416, 1443..1522
2522
GAGAACACAAATCAAAATTTTCAAAAGATTTCAATAGCTGTGAATAACGAAATTACCTT
GCTTTGCTTTGTGTATGGAGATTCTCCTTCAAGCAGAGAACTTCAAAAGCTCTTCGAGGT
CAAGAAGAGAACTTCAGAAACAAAACCCACTACTTCGAGATCGATGAGCTTACTTTGAAA
TCGCGAGCAGATCCAAATCATGTAAAAGAGAACAAGAGATTTCAGATCGTGTAAAAGAGA
AGAAGAGAAAATTTTAGATCGCGGCGTAAATCGTGTTGGCTTTAGGGTTTGATTTTTTTT
TTTGTGTGATTTCTTAAAGATATTAAGCGTGTTTAGGTCATTTGTTACATTAATCGCAGC
TTTTTAATCGTTGCCGCTGAATTAAATCAGCGTTCAAAATTACTCGCTGCAGCATTTTGA
CGTAAGTACGTGCAGCAACAAAACGTACAACGTAATCTGCGTTTGCCGCAACCGTAACTA
CCCGCAACGACGAAACGAACAACATAATTCTAATTTCGGTATAATGGAATGATTTTAGAA
AGGAAAAAAATAATATCATTTCAAATACATCATCCAAATCATTCGTTTATATAATTTATT
TGGATTCAAATGAAGAAAATGGGCTTTTATTTTCAGTACCACTAGAATTACTAACTAGTA
ACTACGTATACTACTAAAAAAACCAAGTGATTTACAAAAACCGATTATTTTTTTTATTTC
AACTGGCCCAATAATATTTTACTCAGCCGACACATACATATGGGCTCTTAATGGGCCATA
TGTTAACTATATCAACGGTTAGGGTTTACATGAAGCAATTAGGGTTTTAAGTTATGCCGC
CTCATAACCATCTATATAAATACAGATTCTCTTCGGTCTCTCATATCATCAGCCACTTTT
CTAGCTTATTCGACCTAATGGTTTACACAGATACATTTAGTATTTCGATTCTCTATTATC
GTGTTTGATTGTTTTTGGTTATTCGGTATTATGTCTCTTCCCGATGAAGAAGCAATCCCA
TAGATAGGAAGTGCCGTATGACACTTTACACAACAACGGACTGAACGACGATGCATCCGG
TGAAATCTCCCAATCCCCGATCAGTCAAACACGAACTCGTATCCGGATCCAAACCCCCGG
ATCCGTTTACGGTCGGGTACTGACTCCTCGGCCGGGTCTTCACCGTACTTCCCACCGTTC
TGTGTCCGTTGTGTGGTTGATTTGACAAGGGTTCGCTGAGGGTTTTTAATTTTTGGTTTA
AGAAAAATTGTCCGATGCCACGTCGACGGTAGCTTTAGGGCAATGATCCTCGATGCTACA
TTGGACATAAACAAATGTACGTGTTTCGCTTACTGATAGGAACCTGTGGATCTTGAATTG
ATTTACGATCTACGGAGCCATTTCGGCGATTACATTTTTTTGATTTGTTTTATTGGGATG
ATTACCGATGATGATTATTGCTAAACTATGGAATTACCGTCTGAGTTTATTCTTTGACGA
GAAAAACGCTGGCTTACTGAGGTTTCCCAATTTTTTTGTAATCAAGTTTTCAAAATTATT
CAATTTTTGTATGTTTTTACTGATGTTGGAACTCAATGAAGATGTTTTTCCTTTGTAAGT
TCTTACAAGAACTCAATTTTTGTCAATTACTGTACTAATTAAGACAGATGTTGGAACTCA
ATGAAGATGATTGTCCTTTGCAAGTTCTTACAAGAACACAATTTTTCTTAATTACTGTAA
TAATTAAGACAGATGTTGGAACGCAATGAAGATGATTGTCATTTGCAAATTCTTACAAGA
ACTCAATTTTTGTTAATTACTGAACAACTTTACACAGATGTTGAAACTGTTAATTACTGA
CTAATTAAGACAGATGTTGATATTCAAAGAAGATGATTCTCTTGCAAGTTCTTATAAGAA
CTCAATTTTTGTTAATTTCTGTACTAAGTAAAGTAGATGTTGAAACTGTTAATTACTGTA
CTAATTAAGGCAGATGTTGGAACTCAAACAAGATGATTGTCCTTCGCAAGTTCTTACAAG
AACTCGATTTTTGTTTATTGCTGTACTAATTAAGTCAGATGTTGAAACTGTAATTACTGT
ACTAATTAAGACATGTTTGGAACCCAATGAAGTTGACTGTCCTTCGCAGGTTCGTACAAG
AACTCAATTTTTGTTAAATACTATAACAGAAGTCTAATGAATAAATCTATAACAATTATT
AAATTAATGATCTTTATTGAATCTACAGACAAAAAAAAGTGATAAAATTGAATGTTGAAG
TAATCTACTTCCAACGATGGTTATAAATTAGAGACCACTTAATCAAAAAAGAATAATCAT
AAACCAATCAAAGTTTTATTATTGATTAAGTTTACTAACTATGTAGGAGGGAAGAATCTG
TTGAGGTTAAAAGGCAAAGTGTAGAACTCTTCATTACGATTATCACCTCTGAAAGTTCTA
AACTTGACCCACCAAGGCATGCCTCTATCTTTCTTTGATCTCTCTACTTCCATTGTGTTG
TCC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003071.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved