Arabidopsis_thaliana Locus poly:SnoR69Y
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:SnoR69Y
Arabidopsis_thaliana
poly:SnoR69Y
SnoR69Y, U29, SnoR25, SnoR53Y
1001..1087, 1239..1327, 1387..1471, 1532..1606
2606
TGGTTAAAAGAAGCAGGTAAGCTGTATAGGCCAAATATATCCTAAAAGAGGTCCAACTC
TTCTAAAATAAAATAAAAAAGATTTAGGTTAGTTACGGCGTCTTTTATGAAACCCTAGTG
TTTCTCTCGTTTCTCTTGCCGTCTCTATAAATCACTTTTCTTTTCGACTCTCCCAAATCC
TCCATCAGACAGGTTTCGATCTCTTTACTTCATAAAAATTGTAGGTTTAAGAGATTCGTT
TAGATATCAATTTAATTCCTCTGGCTGATCATTTTAGTCGTTATCTTTTTCGATCATTTT
TACTATTGTAGAATTAGGGTTTTCGAGGTGATGATGATAACATAAGCGAATAATACTAAA
CTTTAGAACCAAAAAAAATCGATAACCAAATAGATACGTACCAAAACTGTATGGATAACC
GAACGCTCAGGACTACCAAAATTTATATACCTTGTACTCCAATTTTCTTTATTCCAATCC
CGTTAATCTAACCGCGTATAAAACACCACGTACTCCATTTTGATTTCCTGTGAAACCACA
TTTTGTATGATTAGTTGTTGTTGTTGTTAAATAAAAAGATATGATTTATCCCTTTAGTTT
ATTAAACATGACCTTACAAAGACAATTTTAATTGCTGTGGAGGTAAAAATCAAGGGTACA
AGAAGCTGCTAAGCTTTATGGGCCAGATATACCCAAAATAGGTCCAACTATTTAAAGCCC
ATACAAAATGGTCTAGGTTAATTAGTGCTCGTTATATAAAACCCTAGTTTCTCTCTTGCC
GTCTCTATAAAATCTCTTTTCGATTATCAGCAAATTCCTTCATCATAGTCTCCATCGGGT
TTTGATTACTTTGCTCCATGAAAATCGTAGTTTCAAGATTCTTTAAGTCGTATCAATAGG
ATTCAATGTTTTTATCGATTTGGAATCTGGGATTCTCTGTTTCTAGTTGTCTTCTAGTTT
TTGGGTTTGCGAATTATACTATTGTAGAATTAGAGTTCTCGAGGTGATGATGATAACATA
TAATCCCAGCTCTATGAGACCTTTTGTGGTCAAGGAGTATAACTATGTTCATACATTTAT
CTGAGCCTTAGAATTTCTAGCTTCTTGATTGATAAAATCTTTGTTAGATTGGTTTGGTTT
TTGTAAAATAGCGTTTTAAAATCAAATTTGTTAATGTGTGCTCTGTTTAATTTGGTCTAT
TCATTTGCGTATTCATGATTTTTATTTAGGGTTTTGATGTGGCGATGATGATAACATATT
ATCCCAGCTCATTATGAGACCTTTTGTGGTCAAGGAAAATAACTGTTTTCTATAACGTAT
CTGAGCCATAAAAACCCTAAATTCACATTCTTATTTTGATTTTATTAGTAGGAAGATTTT
ATATTTTGTTCCCTGTGATGATTTAAAATCAATACCATGCTAATGTATATTGATAATTTT
TATTTGATTTATAAGTGATTTGCTGAGGGAACTCTTGTATTTTTTAGGAGTTTAGGTTTT
TGTTTTGCCATATGATCTCTTTGAATGTAAGGATTCCCTATGATGGTAATAACCATGCTA
ATACTGATGTCTTGTGACTGAATCAAAGTTATGTGTCTGAGGGAATTTTTTGTTTGCATT
TTTTTGTTTCGTGAACTACATGTGATTGTCGAGGAGATTAATAAAACCTATAAAACTATT
CTAGGCTAATCTTTAAAATTTCGGAACCAATTATTTCCATTTTATCGACTATAAACAATG
GTTAACAAGTGAGCCAATATCGCCATGGCTGAATTATTTACATTATAACTAAACTCTATA
GAGACAAAAATCATCTTGATCTCTGAGATTGATCCCGGAAAGGCCTCTTTATAATATAGA
TCCATCAACTCGAAAACTACAAATTCCAAAGTTCTTTGTGAACTAATTTGTTTTCTCACC
CCCAAACCTTGCCTAATTGTTATGGAGCCCAATAAAGTGAAAACTCAATATTGTTTAGTA
TCTATGAGCCTAATGGGCTTGGGCCAAGACCACTAGATATTAAAGAGAAAATCCCCGCAA
ATTTCATAATCGAGTTCTATTGTATTGCTACAGCACCTTCTGCACATGTCCAAAGCCGGC
ACTGGTCTCAGCCCAGCGCTTTGGTCAGTGAACCTATATACATGTTTGGGTAACCTTCCA
AACAACCATAGATCATGTATGGAAAGAAAGGAATGATAGACGTCTTGGCAACATAGAACG
CCAGCCAGCACTTATAGTTCATCTAATTGAAACTATCAGAGATCGCACGGAAACCATATA
ATGGACCCCGTCTCCGTAATCTCCTGCTTATGTGGTTTCAAGCACGTGCTTTTATATTCC
TAACTTTTTCATCTGAATTTATTGTACATAGCATTACATGCAATATTATTTTTTGTGTAC
TAGTCTACAATATACAGAATATTTGTAAAGGAAATGAAATAATATTTTTTAAAAATATTA
ACATAATAATCTAAGAAATATTGACCATATAAAATAGAAAGATTATAAAATTATGAATCC
CTTTAAAACTTTAAAATTTATATATTTGTCATGGAAAGTTTATTATGTAATAGTTAATAC
TTTACTATATTGTAGAGGTTGTTGACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved