Arabidopsis_thaliana Locus Poly:U61
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:U61
Arabidopsis_thaliana
Poly:U61
2
U61, SnoR14-1, U55, U16
1001..1082, 1162..1239, 1321..1418, 1498..1582
2582
CTCTATTCCCCATCAACTTCTCCTTTTCCAGGCTGAATCATCTATGAACCATTCTTGTT
TCAGGAACCATTGTAAAAGGAGCAGCTTTGTTACACCAGGAAGGTGCTCGGGAGGTATAT
GCGTGCTGCACACACGCTGTTTTCAGGTAAACCACTAACCTATATTTTGTTTGTTCCTGA
ACAGTCTCAAAATCACTACTTCCTGAAGCATTATTTGTTTTCTTTGTTTCAAACAAATCA
ATATGGAAGCCCGCCAGCGATAGAGCGATTATCAGGGGGTTTGCTGCAAGAAGTGATAGT
GACAAACACATTACCTGTAGCAGAGAAGAATTACTTCCCGCAGTTAACAATATTATCAGT
GGCTAATCTCCTGGGTGAGACCATTTGGCGTGTGCATGATGATAGTTCCGTCAGTAGCAT
TTTCCTTTGACCTTTCTCATTGCAACCAACAATTTGAACGATTCTTGGTTTGTTAGTCGG
TTTAGAAAGTTTATCCCGGTTCATGTTCTAACCGGAAAGCTTCAACAAAATTTGCTTGCA
TTGTCTTTTGATACAGCTTAGGTTTTTCTTATTTGCTCCACATCTCAAAATTATGGATGC
ACAAATGGTGTTGAACCGATTTTTTATTATGGTGTACACAAGTTTTTAACTTAATATATA
GAACATCTTGTATCGTATCTACATTTAACATGGTGCAAATTGGCTCAAAAATCTTGTTGA
CAATTTGATAATGGGTTTCATAATCAGACAAATCTATGTATTGGATTGTACAGTCCACGG
CCAACCAAAAAAATAAAAAAAGCCCAAAAGAATAGGTTGAGTCATAATTAGGGCTTCTAT
TTGACTAGTGTCAACTAGTATATATAGAAGACTCACATTGGAATCACAAGACAAGTCTAT
TGTTTTGTGTTCCGCCTCAATTAGTTCTTAGGGTTTTGTCATCTGTGATTTTGTTTGGCT
CTGTTTTTCGATTTGTGCATAGAAATTTATTTAAATAGAAGAGCTGTGAGGAAAAAATCG
TGTGCCAGAGATGGTTAATCCATCGCTGACGGTAATACACAACCCTCTAAGAAGTTCTGA
GCTTTTCTAGATCTTAATCTCTTCCTCAATTCATGTTTTTTTTGGATTTTTGTAAAAACT
CTTTTAAGGACTTTTATGAGTCGAGGTGACGATAGAAATTCACAGGTCTGTCAATCCACT
GATATATGTGATGTAATTGTGTTCTCGACAGGTTCTGATCGACTCTACAATAAAAATCCT
TAAAATCTTGTTTTCAATTTTAATATTTCGTTTTTGTATCCTTAAAAAAATCGTTTTCTT
TTGAATCTGAGTATAGGATGAATCTCATATATTGATGTTATTTACTACTGAAATTACATT
GATGTTTTATTCACCTTGGAGAACTGATACTCAGATTCATAGTCTCTTTTATGTTTTTGT
ACAATTCGAATGTCTTGTCGATTTTAAGGATTTGGTTTTTGATTCTCTTTGTTTTCTACT
GGGCATATGATGAAATTATATTTCATGGGTAATTTGCGTCTGATTCTATGTGATGCTAAC
TTTTATGATTATCTGATGCCCAGAAAATATACCGAATGTTTTTTTTTGTTTTTTTACTAG
TTGTGCATAATGGAAATCACTTGACTAATTAATTTGACTTGTTCACAGTTCTATTCACTT
TAAATGCAAAAACAATTCTCAAAGGTTTTCTACTGATGCCTTGAAATATTTGGATATTTT
ACTTCGGAACAAAACAGAGTCCTTCAATAATTGGAGTTATCAATTGTCAGCTTAGATGAC
AAGCTGAGATTATTTTGACAATTCACTTGCCTTAAGCAGAAACAATTCCAACAAACAGAC
CTGTATCATACTTAATTGGACATTGTTATAATGGAGAAAATAATGGAACTTATCGAAGTT
GTAATGAGTTTTGTGAAGTTGATGCCTTATTGGAAGACCAAAAGAAGTGCAAACAATTTG
TATTGATTGATGTTTGATTTCAGATATTGACAAATCTACAATTCTCCCTAATTTCACCTT
CAATACCTGTAAGAACATTAATATTACCCATTTTTAACATAGATTCCACAAAATCTATGA
AGAAAAGATCTTGATTAACTGCATATTCCCAAACTTTCTGAAAGATCTCTCCTTCATGAT
CTTCTGAGACCAGAACGTTATCCGAAATCAACAACCCTCTCCCTTCTAACAGATTGATGA
AATAATGGTTATCGAAGTAAGCTGGTGTCTTAATATCCAGTGGAGACAGTTCGTTGTCTC
GGCTTGAATCTTTGCATTGTGACCCTAGGACTCGACGGAACGTGCTGTGTCTTCTGAACT
CATCGACGTAGAACGTTTGTTCCATGTTTGGTTGAACAATGCGTTGCTTGAAGCTCACGC
ATCTCGCTTTACCTATTGTATGAGCACCCGAAAGAGCGATGAGATCTTGAATGTTGAGCC
CTTGTTGCTTGAAATTGATGATGAGGCTGTCGAGAGAGGAGTTTGGTGCTGGAATGAATT
GGTTTGCTCCGGCGAAACTTGCCTTTAATGAGTCTCTTCTCCCTAGCAAAACTTCCCACC
ATG
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003071.7
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved