Arabidopsis_thaliana Locus Poly:U61-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:U61-2
Arabidopsis_thaliana
Poly:U61-2
1
U61-2, SnoR14-2, SnoR15, SnoR86-2
1001..1078, 1110..1194, 1256..1350, 1448..1575
2575
TTACTAAATAGAGATTATTCTGTGATTTGCAGGCCATACATTACTAAGAACCAGTTTTT
TATCTTCTTATTTACAGGAACCATTGTGAAAGGAGCAGCTCTTTTACACGAGGAGGGTGC
ACGTGAGGTTTACGCTTGCTGTACACACGCTGTTTTCAGGTAAACCCATTAGCTTGAGTT
TTACCAGTTCTTCTCCATTTTCGTTTATGAAACTAAGAGACCGTTTTCTTGAATGAATCA
ATGTCACAGTCCTCCTGCGATAGAGCGGTTATCAAGCGGTTTGCTGCAAGAAGTGATAGT
GACGAATACTTTACCAGTAGCGGAGAAGAATTACTTCCCGCAGTTAACGATATTATCGGT
GGCTAATCTTCTGGGTGAGACCATTTGGCGTGTCCATGATGATAGCTCCGTTAGTAGTAT
TTTCCTTTGATACTTGTTGGTTTTTGTTAATCGGTTTAGGATCGGTCTAAGTTCCTCTTT
TTTGTTCTACTTCTTCTCGACAGTTTCTAGTCTAACCATGTCTTGCTTCTCTTACTCACC
TAAAGTATGTCACAGTTCTATCTTTTCTTCTTTTTAGCATAATAGAGTTATGAGATATCA
ATGACAATAAAATTTTAATATTTTGGTTTATTGAAAATAATTACATTATGGTGTAAACAT
TATTTCTCAGGATTTATTGAGAATTTCTAAATTAACAATTTCCCCAACTTGCATATTTCT
GGCAATAAATAGTTTTGGCATTTTATGAAATAAGTGACTAATTTTTATGGTTTAGTGTTC
TTTCTTCGGTTAACCAATTTTTATTGCAAAAAAAAAGGAACAAATTAGGGTTTTATCAAG
CCCGTCGTTGCATATAAATAGTCTTTTCATCGCCGCTTGAAACAGATAAGTGTTTCCTTC
GTCTCTCTGTGGTCCGATATGTCTCCCTATAATCTCTGTTTCATAGTTTAATCATATTCT
TTTGTGGTTTTGAATTCTTATGTTCGAAAATCTTGAGTAGTTGCTGTGATGTAACTACCG
TGTGCCAGAGATGAAGTTATTCATCGTTGACGGCAAACATAACCTTAGAGTTCTAAGCTT
TTCTTTTGTTCTATTTTTTGGTGTGTGGTCGAAGTGACGATAAAGAATTCACAGTCTGTC
AATCCACTGACAACATTTGAGTGATGTTATTGTGATATCTCGACAGGTTCTGATCTACTC
TTAATAAAAACCCTCCCAATGATTTTTTTTTATTAGATCATTAGTTTTGTTGAAAGTGGG
GCAGATGATGATTATCATAAAACAAATGGGTAATTTGCGACTGATAATATTACATTGATG
TGTTTTTCACCTTGGAGAACTGATGTCCCCAATCTCATATTCTAAGTTCTATTTTTTTTG
GTATTGATAATGAATTCGTGAAGAGTTCGATTTGTTTCTTCTTGTCATAAACATTAAGCC
AATTAGCAGAGCAAGGGCGTCTAGTTTAAATGACGTGAGTTGCCTTGAAGGTTGGCGATA
ACAAGTTTTGCGATTCTCCGTGCCTATCAAATTTTGTTTTTCGTATTGATAATGGCCTCG
AACAAGTCGCTACATTCGTTTTTTTTCTTCCAAAGATTTTGTTTCAAAAGAAGTCTCTTA
TGTAATAATTAAAATTCAGAATAAAAATCAGGTTATTTACGATCATAACTAACCAAACGC
TTAGACAATATGCTTATCAGTTGAGATTATAGTCCCGTAGGTGGAGCAATGGTCGGATAG
TTAATGTGCAGCTATGATTAAAGCATATTTGTAGACTAAATGTTTGGATGGTTAAATTAA
AGCCCAATTATGATAAGAACCTTTGTAAACCGGGGATGGGTTCAATGTACAAAAGTGTAT
ATGTCTGAACATTAATTCAACAAATTGATGGCCATGAATCCCATATTAGGAAGGAAAAAA
AACAATAAAATGAAGGTAAAGACCACCATAATGGGGACAATTTTCGTCGCATTTTTTTCC
AAAAAAAACACGTTAGTCCTTGACTCATTTGAAGACAAGCTCAAAGTGATATTTGCGAGT
TGTAACGGTAAACGATTGGATTCCCTAACTAGGCAAATACCACTATGGACTTTATGTAGA
ATATGGAAGAGTCGAAATCTCCTGGGTTTATCAACGTCGGTCTAGCGAATGGAGACGAGA
TGCACAACAGGCGATCACTGAATAGAAACGAGTCGAATTAAATGGTTGTCACGTTAGGAG
AAAATTTTGATGTGGTAGAGTTGATTAATACAAATTTTGAAATTTTACAATAAATAAAAG
AAAATATATGCAGTTATTTATGTATATCTATGGCAAAAAATAATTGATTGTTTTTTGTTT
TAAACAATGTTTGCGCCTATATGGTTGTGGTAAGCTTCAAATGTGTTACAAACTGAACTC
TGACAAATTTGTTTCAATCTCTCTATAGCAAGTTAGTCATAAATTCCAATAGCAAATCGT
TACGCTTCAAATGTGTTACAAACTAAACTTTGATAAATTTGTTTCAATCTTTCTGTAACA
TTTTTCATCTACCTTTGCATCCGAAGCTGAATTTCACGATCAGAATATTGTTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003070.9
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved