Arabidopsis_thaliana Locus poly:U31b
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana poly:U31b
Arabidopsis_thaliana
poly:U31b
1
U31b, SnoR4b, U33b, U51b, SnoR5b
1001..1090, 1131..1207, 1261..1342, 1381..1470, 1515..1654
2594
AAGAAAACCGAGTCGAACGGCAACGTGATTGGTCCACCCGCCCTGAGGCCGAACTCTTC
TTCAGATATCTTCAAGAGCTCTTCGAAAACAGAGTTGTTCAAGTAACTTAACGGAAAAGC
AAAGCGGATTTTATCAACCGTGTAAACCACGAAACAGCCCTTCTCCACAGCAGTTGAGCT
GCTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTTGATCTTTGGAATGAGATTCTTTT
CCTCTTGAGGGCAGCTCTTTGTTGCCATTTCTTGGCCATCTTGAGTAGTTTCTTAGTGTT
GATCATCTTTACTAATAGAAAGAGAGCAAACAAAAAAGGGATTGTAAGTTGTGTTGTAGT
ATAAATCTCTGAAGTAATGAAAGTGGTGAATGATGAAGAATGCTCTAAGCTTTGTTGCAT
TTTATATATAAAGAGAAAGTATTAGAGTTTTAGATATAATTAAGAGCAACCAAAGAAGAC
AGAAACACATGCTCTTGTAGTTCTTGTCTAAAGAGGTCCCAAACTAGTAATCAATCATAT
CTGCTAAATCAATTTGTGGATTAGAAACCATTAACATGGTGAGAAGAAACATGACCATGT
GGGGGTATTAAATCAATGTTACAAAGACATTTGAAGGTGAAAGAAAAGATGCGGGTCCTC
TCATGTTCTCAGAGATGTAAAAAAACCTTAAACCTAGAGAAATTTTTGGAATACCGGTTT
AATTAAATGTAAACCGAACTGAACCGAAAACCCTTATTAGCTACCTGTGAACTGCCTCTT
ATATAAAGCCGTCGCTGACAATCTCATAGGAGACTCGAGAGAGTCCTAAACTTTCAAAAC
TAGTGATTATCTTCGAGTCATGTCATGTTAGCGTTTAGGGGTTTTGTGTGTCTATCCACA
TGTTTTCTGCTTCTATATAAACCCTAACGCTCTCGATACTCTAGTTGTTGTGTAAGTAGG
TGTTGTTTTGTGTCTATGTTTCTTCGTTAGCTCAGATTGAGGAAAGTGATGATAAGGAAT
TGTCGCCCCAGGCTTAATCTGCATCCATTACGATGGTTGTAACATGGTGATTGACTATCT
CTGTCTGATTCTTCGAATCTTTTCTTAGATTGTTTTATAATGTTTGTGAATGGATATGAC
GAAATGGCAATAATGTTTTGTGACACCCAGTCTGATCTTCGTGATTGATCTGCCATATTT
TCTGATCCTAATTCTTCTTCAGTTTTGTGGATTTTGATTCAAAGTTTTGATTTTTGAAAG
GGAGGGATGAGGATATAATTCCATACGTCTGCAAATCTGAAACACAGTGTTGATACAATT
GACATGCACTACCATCTGACCTCTGTTTTATTGTTGTTTTCAATACCCTTTTGTTAGTTG
TCTGCAATCAGTGATGAAATTATGTCAAATTCAATGATTATACAATGATTATTATAATCA
CTAGATCACCATCTTTCGGCTGAGATTGCAGTTTTTCTTTTTTGGAATTATTGTTTGTGT
TATTGTTGACGATTTGCCTATGGTATCTGATGTCCAAAGTTTGATAATTGTGTTTGGACA
TTTCGTTTTTCTTAGGCAGAAAGTGATTTCAGGCTTTGCGACACTGTTAGCTTATCACAT
AAGCTACCTGTTACTTTTAATACCTGGTTACATCCTATTTTTCAATATCAATGTTGTTTT
CGTTTTGTTTATATTCCATCTTGTTTGGTGGTTACATTCCAAATCTTTTTGTAATAGCAT
CCTCTGTGTTTGACTTTAGTTTGATCTTATGAAGACTCTTTGACTCAATCCCAATCTACT
GATGCTTCTGTGTTTTATTGTCAAGTTCATGTAAGCGTGGTTACTTCAGAAAGTGAAGAG
CATTGCTTGGACTTCAATGGGATTTACATTGGTATTTACTGGATTGTCAGAGTCCGCCCA
AGTGCTTATTGGACTATCTGGAGTTACTCCTATCTGTATCATGAATTCTTATGTAATTTT
TCTGTGACGTGTAATGATTATTGTTCCACTGATATTAAAAGATGATGACAGAGTTATTAC
CCTTTTGAACCTTGTTGGTATATAAGTTAACTTCACTGTCCGGAATCTATACTCTTTTGT
TTGGACCCGAAATTTACATGTGACAATTAAGTTTGAGCAAATGAAATACACAATGCTTAT
GGTTTGATGTGTTGGTCTTTGAGGACCTTTACTCCCTAGCTGGAGTTTTCCAAAATCTGT
CACATTAGTGTCTCTTCTCTATGCTTCATATCAACCATTGTCTCCTTTCCCCTTGCCTTT
CAGTTTCAGTATCTCTCATCACTTGTTGAGCTTGATTCTTGATAACAAAGATTGACAGAA
TTGGAATATAAGGACTGTTGTTGGACCAAAATCAAATGACTTTGAACACAATTGTTGGAT
CGTAAAAGGCTTTGACAGAGGAAGATTGCAGCACTTCTTACACAGAGGAAATGCTTGCTT
GAATAAGAAGAATAAGGATTCTATGTGTGTTGTTTAGGACCAAAGCAAAAGCTCATTATA
CGATAAGATTACACTTTTGTCTTGTATACAACTTTCTTCAATGCAAAAAAGGGATACAAA
TATTCGACTAATACA
  Untranslated Region
  Coding Sequence
  snoRNA
CP002684 NC_003070
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved